BIGBIO

BigBio = BIG DATA for Ruby

BigBio is an initiative to a create high performance libraries for big data computing in biology.

BigBio may use BioLib C/C++/D functions for increasing performance and reducing memory consumption.

In a way, this is an experimental project. I use it for experimentation, but what is in here should work fine. If you wish to contribute subscribe to the BioRuby and/or BioLib mailing lists instead.

Overview

Installation

The easy way

gem install bio-bigbio

in your code

require 'bigbio'

Command line tools

Some functionality comes also as executable command line tools (see the ./bin directory). Use the -h switch to get information. Current tools are

  1. getorf: fetch all areas between start-stop and stop-stop codons in six frames (using EMBOSS when biolib is available)

  2. nt2aa.rb: translate in six frames (using EMBOSS when biolib is available)

  3. fasta_filter.rb

Command line Fasta Filter

The CLI filter accepts standard Ruby commands.

Filter sequences that contain more than 25% C’s

fasta_filter.rb --filter "rec.seq.count('C') > rec.seq.size*0.25" test/data/fasta/nt.fa

Look for IDs containing -126 and sequences ending on CCC

fasta_filter.rb --filter "rec.id =~ /-126/ or rec.seq =~ /CCC$/" test/data/fasta/nt.fa

Filter out all masked sequences that contain more than 10% masked nucleotides

fasta_filter.rb --filter "rec.seq.count('N')<rec.seq.size*0.10"

Next to rec.id and rec.seq, you have rec.descr and ‘num’ as variables, so to skip every other record

fasta_filter.rb --filter "num % 2 == 0"

Find all sequences that contain a stop codon in the sequence

fasta_filter.rb --filter 'rec.seq =~ /\*./' aa.fa

Rewrite all sequences to lower case, you can use the useful rewrite option

fasta_filter.rb --rewrite 'rec.seq = rec.seq.downcase'

Rewrite the FASTA descriptors

fasta_filter.rb --rewrite 'rec.descr =~ /gene=(\S+)/; rec.descr = $1' test.fa

Filters and rewrites can be combined. The rest is up to your imagination! One final example to remove low quality sequences from an amino acid file (one amino acid dominates):

fasta_filter.rb --filter "count = {} ; rec.seq.each_char { |c| count[c] ||= 1 ; count[c] += 1 }; count.values.max.to_f/rec.seq.size < 0.30" < aa.fa > aa1.fa

API Examples

Iterate through a FASTA file

Read a file without loading the whole thing in memory

require 'bigbio'

fasta = FastaReader.new(fn)
fasta.each do | rec |
  print rec.descr,rec.seq
end

Since FastaReader parses the ID, write a tab file with id and sequence

i = 1
print "num\tid\tseq\n"
FastaReader.new(fn).each do | rec |
  if rec.id =~ /(AT\w+)/
    print i,"\t",$1,"\t",rec.seq,"\n"
    i += 1
  end
end

wich, for example, can be turned into RDF with the bio-table biogem.

Write a FASTA file

Write a FASTA file. The simple way

fasta = FastaWriter.new(fn)
fasta.write('Test',"agtcta")

Any object can be passed in, however, as long as it responds to ‘descr’ and ‘seq.to_s’, or ‘id’ and ‘seq.to_s’. E.g.

class StorageObject
  attr_accessor :descr, :seq
end

mysequence = StorageObject.new
mysequence.descr = 'Test'
mysequence.seq = "agtcta"

write the FASTA file

fasta = FastaWriter.new(fn)
fasta.write(mysequence)

Transform a FASTA file

You can combine above FastaReader and FastaWriter to transform sequences, e.g.

fasta = FastaWriter.new(in_fn)
FastaReader.new(out_fn).each do | rec |
  # Strip the description down to the second ID
  (id1,id2) = /(\S+)\s+(\S+)/.match(rec.descr)
  fasta.write(id2,rec.seq)
end

The downside to this approach is the explicit file naming. What if you want to use STDIN or some other source instead? I have come round to the idea of using a combination of lambda and block. For example:

FastaReader::emit_fastarecord(-> {gets}) { |rec|
    print FastaWriter.to_fasta(rec)
  }

which takes STDIN line by line, and outputs FASTA on STDOUT. This is a better design as the FastaReader and FastaWriter know nothing of the mechanism fetching and displaying data. These can both be ‘pure’ functions. Note also that the data is never fully loaded into RAM.

Here the transformer functional style

FastaReader::emit_fastarecord(-> {gets}) { |rec|
    (id1,id2) = /(\S+)\s+(\S+)/.match(rec.descr)
    print FastaWriter.to_fasta(id2,req.seq)
  }

Fetch ORFs from a sequence

BigBio can parse a sequence for ORFs. Together with the FastaReader little memory gets used

predictorf = PredictORF.new(id,descr,"ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")
# get all ORFs between start and stop codons, longer than 30 bps
orfs = predictorf.startstop(30)
# get all sequences between stop codons
seqs = predictorf.stopstop(0)

Rapid DNA/RNA to amino acid translation

Translate with EMBOSS C library, if linked, otherwise use BioRuby

trn_table = Bio::Big::TranslationAdapter.translation_table(1)
translate = Nucleotide::Translate.new(trn_table)
aa_frames = translate.aa_6_frames("ATCATTAGCAACACCAGCTTCCTCTCTCTCGCTTCAAAGTTCACTACTCGTGGATCTCGT")

Project home page

Information on the source tree, documentation, examples, issues and how to contribute, see

github.com/pjotrp/bigbio

The BioRuby community is on IRC server: irc.freenode.org, channel: bioruby.

Cite

If you use this software, please cite one of

Biogems.info

This Biogem is published on biogems.info

Copyright

Copyright © 2011-2014 Pjotr Prins. See LICENSE for further details.