Warning: Permanently added '34.229.20.25' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/8412002-fedora-rawhide-x86_64 --chroot fedora-rawhide-x86_64 Version: 1.2 PID: 55331 Logging PID: 55332 Task: {'allow_user_ssh': False, 'appstream': False, 'background': True, 'build_id': 8412002, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-x86_64', 'enable_net': False, 'fedora_review': False, 'git_hash': 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-5', 'project_dirname': 'gcc-15-smoketest-3', 'project_name': 'gcc-15-smoketest-3', 'project_owner': 'dmalcolm', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/dmalcolm/gcc-15-smoketest-3/fedora-rawhide-x86_64/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}, {'baseurl': 'https://fedorapeople.org/~dmalcolm/gcc/gcc-15-mass-prebuild/$basearch', 'id': 'https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch', 'name': 'Additional repo https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch'}], 'sandbox': 'dmalcolm/gcc-15-smoketest-3--dmalcolm', 'source_json': {}, 'source_type': None, 'ssh_public_keys': None, 'storage': 0, 'submitter': 'dmalcolm', 'tags': [], 'task_id': '8412002-fedora-rawhide-x86_64', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie'... Running: git checkout ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e -- cmd: ['git', 'checkout', 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie rc: 0 stdout: stderr: Note: switching to 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at ca92ec3 automatic import of bowtie Running: dist-git-client sources cmd: ['dist-git-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/dmalcolm/gcc-15-smoketest-3/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 17.5M 0 --:--:-- --:--:-- --:--:-- 17.5M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/dmalcolm/gcc-15-smoketest-3/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 2656k 0 --:--:-- --:--:-- --:--:-- 2777k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated Running (timeout=115200): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1734557438.910773 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 5.9 starting (python version = 3.13.0, NVR = mock-5.9-1.fc41), args: /usr/libexec/mock/mock --spec /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1734557438.910773 -r /var/lib/copr-rpmbuild/results/configs/child.cfg Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie/bowtie.spec) Config(fedora-rawhide-x86_64) Start: clean chroot Finish: clean chroot Mock Version: 5.9 INFO: Mock Version: 5.9 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1734557438.910773/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using bootstrap image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Copy content of container registry.fedoraproject.org/fedora:rawhide to /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1734557438.910773/root INFO: Checking that registry.fedoraproject.org/fedora:rawhide image matches host's architecture INFO: mounting registry.fedoraproject.org/fedora:rawhide with podman image mount INFO: image registry.fedoraproject.org/fedora:rawhide as /var/lib/containers/storage/overlay/20264d84b038c0676961d488450f3d7ec1848d7a526bdc9503d1c1a787d88a3c/merged INFO: umounting image registry.fedoraproject.org/fedora:rawhide (/var/lib/containers/storage/overlay/20264d84b038c0676961d488450f3d7ec1848d7a526bdc9503d1c1a787d88a3c/merged) with podman image umount INFO: Package manager dnf5 detected and used (fallback) INFO: Not updating bootstrap chroot, bootstrap_image_ready=True Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1734557438.910773/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf5 detected and used (direct choice) INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.20.0-1.fc42.x86_64 rpm-sequoia-1.7.0-3.fc42.x86_64 dnf5-5.2.8.1-2.fc42.x86_64 dnf5-plugins-5.2.8.1-2.fc42.x86_64 Start: installing minimal buildroot with dnf5 Updating and loading repositories: fedora 100% | 456.0 KiB/s | 26.0 KiB | 00m00s Copr repository 100% | 61.2 KiB/s | 1.5 KiB | 00m00s Additional repo https_fedorapeople_org 100% | 25.0 KiB/s | 1.5 KiB | 00m00s Copr repository 100% | 21.2 MiB/s | 848.2 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing group/module packages: bash x86_64 5.2.37-1.fc42 fedora 8.2 MiB bzip2 x86_64 1.0.8-19.fc41 fedora 95.7 KiB coreutils x86_64 9.5-11.fc42 fedora 5.4 MiB cpio x86_64 2.15-2.fc41 fedora 1.1 MiB diffutils x86_64 3.10-8.fc41 fedora 1.6 MiB fedora-release-common noarch 42-0.11 fedora 19.8 KiB findutils x86_64 1:4.10.0-4.fc41 fedora 1.8 MiB gawk x86_64 5.3.0-4.fc41 fedora 1.7 MiB glibc-minimal-langpack x86_64 2.40.9000-24.fc42 fedora 0.0 B grep x86_64 3.11-9.fc41 fedora 1.0 MiB gzip x86_64 1.13-2.fc41 fedora 389.0 KiB info x86_64 7.1.1-2.fc42 fedora 361.8 KiB patch x86_64 2.7.6-25.fc41 fedora 266.7 KiB redhat-rpm-config noarch 300-1.no_annobin.0.fc42 copr_base 186.6 KiB rpm-build x86_64 4.20.0-1.fc42 fedora 194.3 KiB sed x86_64 4.9-3.fc41 fedora 861.5 KiB shadow-utils x86_64 2:4.17.0~rc1-1.fc42 fedora 4.1 MiB tar x86_64 2:1.35-4.fc41 fedora 2.9 MiB unzip x86_64 6.0-65.fc42 fedora 398.2 KiB util-linux x86_64 2.40.2-8.fc42 fedora 3.7 MiB which x86_64 2.21-42.fc41 fedora 80.2 KiB xz x86_64 1:5.6.3-2.fc42 fedora 1.2 MiB Installing dependencies: add-determinism x86_64 0.4.3-1.fc42 fedora 2.4 MiB alternatives x86_64 1.30-1.fc41 fedora 66.3 KiB ansible-srpm-macros noarch 1-16.fc41 fedora 35.7 KiB audit-libs x86_64 4.0.2-1.fc42 copr_base 331.3 KiB authselect x86_64 1.5.0-8.fc42 copr_base 156.0 KiB authselect-libs x86_64 1.5.0-8.fc42 copr_base 820.0 KiB basesystem noarch 11-21.fc41 fedora 0.0 B binutils x86_64 2.43.50-9.fc42 copr_base 25.6 MiB build-reproducibility-srpm-macros noarch 0.4.3-1.fc42 fedora 735.0 B bzip2-libs x86_64 1.0.8-19.fc41 fedora 80.7 KiB ca-certificates noarch 2024.2.69_v8.0.401-3.fc42 fedora 2.6 MiB coreutils-common x86_64 9.5-11.fc42 fedora 11.2 MiB cracklib x86_64 2.9.11-6.fc41 fedora 238.9 KiB crypto-policies noarch 20241128-1.gitbb7b0b0.fc42 fedora 137.3 KiB curl x86_64 8.11.1-2.fc42 fedora 452.0 KiB cyrus-sasl-lib x86_64 2.1.28-27.fc41 fedora 2.3 MiB debugedit x86_64 5.1-2.fc42 fedora 200.3 KiB dwz x86_64 0.15-8.fc42 fedora 299.2 KiB ed x86_64 1.20.2-2.fc41 fedora 146.9 KiB efi-srpm-macros noarch 5-13.fc42 fedora 40.2 KiB elfutils x86_64 0.192-7.fc42 fedora 2.6 MiB elfutils-debuginfod-client x86_64 0.192-7.fc42 fedora 81.4 KiB elfutils-default-yama-scope noarch 0.192-7.fc42 fedora 1.8 KiB elfutils-libelf x86_64 0.192-7.fc42 fedora 1.2 MiB elfutils-libs x86_64 0.192-7.fc42 fedora 662.9 KiB fedora-gpg-keys noarch 42-0.3 fedora 126.4 KiB fedora-release noarch 42-0.11 fedora 0.0 B fedora-release-identity-basic noarch 42-0.11 fedora 719.0 B fedora-repos noarch 42-0.3 fedora 4.9 KiB fedora-repos-rawhide noarch 42-0.3 fedora 2.2 KiB file x86_64 5.45-8.fc42 fedora 103.7 KiB file-libs x86_64 5.45-8.fc42 fedora 9.9 MiB filesystem x86_64 3.18-29.fc42 fedora 106.0 B filesystem-srpm-macros noarch 3.18-29.fc42 fedora 36.1 KiB fonts-srpm-macros noarch 1:2.0.5-17.fc41 fedora 55.8 KiB forge-srpm-macros noarch 0.4.0-1.fc42 fedora 38.9 KiB fpc-srpm-macros noarch 1.3-13.fc41 fedora 144.0 B gdb-minimal x86_64 15.2-4.fc42 fedora 12.7 MiB gdbm x86_64 1:1.23-7.fc41 fedora 460.9 KiB gdbm-libs x86_64 1:1.23-7.fc41 fedora 121.9 KiB ghc-srpm-macros noarch 1.9.2-1.fc42 fedora 779.0 B glibc x86_64 2.40.9000-24.fc42 fedora 6.7 MiB glibc-common x86_64 2.40.9000-24.fc42 fedora 1.0 MiB glibc-gconv-extra x86_64 2.40.9000-24.fc42 fedora 8.0 MiB gmp x86_64 1:6.3.0-2.fc41 fedora 811.4 KiB gnat-srpm-macros noarch 6-6.fc41 fedora 1.0 KiB go-srpm-macros noarch 3.6.0-5.fc42 fedora 60.8 KiB jansson x86_64 2.14-1.fc42 fedora 93.1 KiB json-c x86_64 0.18-1.fc42 fedora 83.3 KiB kernel-srpm-macros noarch 1.0-24.fc41 fedora 1.9 KiB keyutils-libs x86_64 1.6.3-4.fc41 fedora 54.4 KiB krb5-libs x86_64 1.21.3-3.fc42 fedora 2.3 MiB libacl x86_64 2.3.2-2.fc42 copr_base 38.3 KiB libarchive x86_64 3.7.7-1.fc42 fedora 932.3 KiB libattr x86_64 2.5.2-4.fc41 fedora 28.5 KiB libblkid x86_64 2.40.2-8.fc42 fedora 262.5 KiB libbrotli x86_64 1.1.0-5.fc41 fedora 837.6 KiB libcap x86_64 2.71-1.fc42 fedora 210.8 KiB libcap-ng x86_64 0.8.5-3.fc41 fedora 69.2 KiB libcom_err x86_64 1.47.1-6.fc42 fedora 67.2 KiB libcurl x86_64 8.11.1-2.fc42 fedora 817.3 KiB libeconf x86_64 0.7.5-1.fc42 fedora 66.7 KiB libevent x86_64 2.1.12-14.fc41 fedora 895.7 KiB libfdisk x86_64 2.40.2-8.fc42 fedora 362.9 KiB libffi x86_64 3.4.6-3.fc42 fedora 86.4 KiB libgcc x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 266.9 KiB libgomp x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 529.3 KiB libidn2 x86_64 2.3.7-2.fc41 fedora 329.1 KiB libmount x86_64 2.40.2-8.fc42 fedora 355.8 KiB libnghttp2 x86_64 1.64.0-1.fc42 fedora 174.5 KiB libnsl2 x86_64 2.0.1-2.fc41 fedora 57.9 KiB libpkgconf x86_64 2.3.0-1.fc42 fedora 78.2 KiB libpsl x86_64 0.21.5-4.fc41 fedora 80.5 KiB libpwquality x86_64 1.4.5-11.fc41 fedora 417.8 KiB libselinux x86_64 3.8-0.rc1.2.fc42 fedora 191.6 KiB libsemanage x86_64 3.8-0.rc1.1.fc42 fedora 305.3 KiB libsepol x86_64 3.8-0.rc1.1.fc42 fedora 822.0 KiB libsmartcols x86_64 2.40.2-8.fc42 fedora 180.4 KiB libssh x86_64 0.11.1-1.fc42 fedora 569.6 KiB libssh-config noarch 0.11.1-1.fc42 fedora 277.0 B libstdc++ x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 2.7 MiB libtasn1 x86_64 4.19.0-9.fc41 fedora 175.7 KiB libtirpc x86_64 1.3.6-1.fc42 fedora 205.5 KiB libtool-ltdl x86_64 2.5.4-1.fc42 copr_base 68.1 KiB libunistring x86_64 1.1-8.fc41 fedora 1.7 MiB libuuid x86_64 2.40.2-8.fc42 fedora 41.4 KiB libverto x86_64 0.3.2-9.fc41 fedora 29.5 KiB libxcrypt x86_64 4.4.36-11.fc42 fedora 271.4 KiB libxml2 x86_64 2.12.8-2.fc41 fedora 1.7 MiB libzstd x86_64 1.5.6-2.fc41 fedora 795.9 KiB lua-libs x86_64 5.4.7-1.fc42 fedora 285.0 KiB lua-srpm-macros noarch 1-14.fc41 fedora 1.3 KiB lz4-libs x86_64 1.10.0-1.fc41 fedora 145.5 KiB mpfr x86_64 4.2.1-5.fc41 fedora 832.1 KiB ncurses-base noarch 6.5-2.20240629.fc41 fedora 326.3 KiB ncurses-libs x86_64 6.5-2.20240629.fc41 fedora 975.2 KiB ocaml-srpm-macros noarch 10-3.fc41 fedora 1.9 KiB openblas-srpm-macros noarch 2-18.fc41 fedora 112.0 B openldap x86_64 2.6.8-6.fc42 fedora 647.4 KiB openssl-libs x86_64 1:3.2.2-8.fc42 fedora 7.8 MiB p11-kit x86_64 0.25.5-4.fc42 fedora 2.2 MiB p11-kit-trust x86_64 0.25.5-4.fc42 fedora 403.8 KiB package-notes-srpm-macros noarch 0.5-12.fc41 fedora 1.6 KiB pam x86_64 1.7.0-3.fc42 fedora 1.8 MiB pam-libs x86_64 1.7.0-3.fc42 fedora 139.4 KiB pcre2 x86_64 10.44-1.fc41.1 fedora 653.5 KiB pcre2-syntax noarch 10.44-1.fc41.1 fedora 251.6 KiB perl-srpm-macros noarch 1-56.fc41 fedora 861.0 B pkgconf x86_64 2.3.0-1.fc42 fedora 88.6 KiB pkgconf-m4 noarch 2.3.0-1.fc42 fedora 14.4 KiB pkgconf-pkg-config x86_64 2.3.0-1.fc42 fedora 989.0 B popt x86_64 1.19-7.fc41 fedora 136.9 KiB publicsuffix-list-dafsa noarch 20240107-4.fc41 fedora 67.5 KiB pyproject-srpm-macros noarch 1.16.3-1.fc42 fedora 1.9 KiB python-srpm-macros noarch 3.13-3.fc41 fedora 51.0 KiB qt5-srpm-macros noarch 5.15.15-1.fc42 fedora 500.0 B qt6-srpm-macros noarch 6.8.1-4.fc42 fedora 456.0 B readline x86_64 8.2-11.fc42 fedora 493.1 KiB rpm x86_64 4.20.0-1.fc42 fedora 3.1 MiB rpm-build-libs x86_64 4.20.0-1.fc42 fedora 206.7 KiB rpm-libs x86_64 4.20.0-1.fc42 fedora 726.1 KiB rpm-sequoia x86_64 1.7.0-3.fc42 fedora 2.3 MiB rust-srpm-macros noarch 26.3-3.fc42 fedora 4.8 KiB setup noarch 2.15.0-5.fc41 fedora 720.7 KiB sqlite-libs x86_64 3.47.2-1.fc42 fedora 1.4 MiB systemd-libs x86_64 257-1.fc42 fedora 2.2 MiB util-linux-core x86_64 2.40.2-8.fc42 fedora 1.5 MiB xxhash-libs x86_64 0.8.2-4.fc42 fedora 88.4 KiB xz-libs x86_64 1:5.6.3-2.fc42 fedora 218.4 KiB zig-srpm-macros noarch 1-3.fc41 fedora 1.1 KiB zip x86_64 3.0-42.fc42 fedora 695.9 KiB zlib-ng-compat x86_64 2.2.2-1.fc42 fedora 134.0 KiB zstd x86_64 1.5.6-2.fc41 fedora 1.7 MiB Installing groups: Buildsystem building group Transaction Summary: Installing: 155 packages Total size of inbound packages is 52 MiB. Need to download 0 B. After this operation, 178 MiB extra will be used (install 178 MiB, remove 0 B). [1/1] tar-2:1.35-4.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [1/1] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/2] bzip2-0:1.0.8-19.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [2/2] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/3] rpm-build-0:4.20.0-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [3/3] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/4] unzip-0:6.0-65.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [4/4] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/5] cpio-0:2.15-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [5/5] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/6] which-0:2.21-42.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [6/6] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/7] bash-0:5.2.37-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [7/7] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/8] coreutils-0:9.5-11.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [8/8] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/9] grep-0:3.11-9.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [9/9] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/10] patch-0:2.7.6-25.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [10/10] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/11] sed-0:4.9-3.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [11/11] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/12] shadow-utils-2:4.17.0~rc1-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [12/12] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/13] diffutils-0:3.10-8.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [13/13] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/14] fedora-release-common-0:42-0.11 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [14/14] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/15] findutils-1:4.10.0-4.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [15/15] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/16] glibc-minimal-langpack-0:2.40.9 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [16/16] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/17] gzip-0:1.13-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [17/17] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/18] info-0:7.1.1-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [18/18] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/19] xz-1:5.6.3-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [19/19] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/20] redhat-rpm-config-0:300-1.no_an 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [20/20] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/21] util-linux-0:2.40.2-8.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [21/21] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/22] gawk-0:5.3.0-4.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [22/22] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/23] glibc-0:2.40.9000-24.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [23/23] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/24] libselinux-0:3.8-0.rc1.2.fc42.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [24/24] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/25] bzip2-libs-0:1.0.8-19.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [25/25] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/26] debugedit-0:5.1-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [26/26] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/27] elfutils-0:0.192-7.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [27/27] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/28] elfutils-libelf-0:0.192-7.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [28/28] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/29] file-0:5.45-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [29/29] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/30] libarchive-0:3.7.7-1.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [30/30] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/31] popt-0:1.19-7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [31/31] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/32] readline-0:8.2-11.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [32/32] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/33] rpm-0:4.20.0-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [33/33] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/34] rpm-build-libs-0:4.20.0-1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [34/34] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/35] rpm-libs-0:4.20.0-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [35/35] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/36] zstd-0:1.5.6-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [36/36] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/37] filesystem-0:3.18-29.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [37/37] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/38] ncurses-libs-0:6.5-2.20240629.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [38/38] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/39] coreutils-common-0:9.5-11.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [39/39] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/40] gmp-1:6.3.0-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [40/40] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/41] libattr-0:2.5.2-4.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [41/41] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/42] libcap-0:2.71-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [42/42] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/43] openssl-libs-1:3.2.2-8.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [43/43] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/44] systemd-libs-0:257-1.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [44/44] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/45] pcre2-0:10.44-1.fc41.1.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [45/45] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/46] ed-0:1.20.2-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [46/46] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/47] libeconf-0:0.7.5-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [47/47] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/48] libsemanage-0:3.8-0.rc1.1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [48/48] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/49] libxcrypt-0:4.4.36-11.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [49/49] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/50] pam-libs-0:1.7.0-3.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [50/50] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/51] setup-0:2.15.0-5.fc41.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [51/51] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/52] fedora-repos-0:42-0.3.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [52/52] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/53] glibc-common-0:2.40.9000-24.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [53/53] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/54] xz-libs-1:5.6.3-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [54/54] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/55] ansible-srpm-macros-0:1-16.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [55/55] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/56] build-reproducibility-srpm-macr 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [56/56] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/57] dwz-0:0.15-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [57/57] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/58] efi-srpm-macros-0:5-13.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [58/58] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/59] filesystem-srpm-macros-0:3.18-2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [59/59] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/60] fonts-srpm-macros-1:2.0.5-17.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [60/60] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/61] forge-srpm-macros-0:0.4.0-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [61/61] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/62] fpc-srpm-macros-0:1.3-13.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [62/62] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/63] ghc-srpm-macros-0:1.9.2-1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [63/63] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/64] gnat-srpm-macros-0:6-6.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [64/64] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/65] go-srpm-macros-0:3.6.0-5.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [65/65] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/66] kernel-srpm-macros-0:1.0-24.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [66/66] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/67] lua-srpm-macros-0:1-14.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [67/67] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/68] ocaml-srpm-macros-0:10-3.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [68/68] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/69] openblas-srpm-macros-0:2-18.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [69/69] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/70] package-notes-srpm-macros-0:0.5 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [70/70] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/71] perl-srpm-macros-0:1-56.fc41.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [71/71] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/72] pyproject-srpm-macros-0:1.16.3- 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [72/72] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/73] python-srpm-macros-0:3.13-3.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [73/73] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/74] qt5-srpm-macros-0:5.15.15-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [74/74] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/75] qt6-srpm-macros-0:6.8.1-4.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [75/75] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/76] rust-srpm-macros-0:26.3-3.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [76/76] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/77] zig-srpm-macros-0:1-3.fc41.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [77/77] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/78] zip-0:3.0-42.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [78/78] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/79] libblkid-0:2.40.2-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [79/79] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/80] libcap-ng-0:0.8.5-3.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [80/80] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/81] libfdisk-0:2.40.2-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [81/81] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/82] libmount-0:2.40.2-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [82/82] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/83] libsmartcols-0:2.40.2-8.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [83/83] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/84] libuuid-0:2.40.2-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [84/84] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/85] util-linux-core-0:2.40.2-8.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [85/85] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/86] zlib-ng-compat-0:2.2.2-1.fc42.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [86/86] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/87] mpfr-0:4.2.1-5.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [87/87] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/88] glibc-gconv-extra-0:2.40.9000-2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [88/88] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/89] basesystem-0:11-21.fc41.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [89/89] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/90] libsepol-0:3.8-0.rc1.1.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [90/90] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/91] elfutils-libs-0:0.192-7.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [91/91] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/92] elfutils-debuginfod-client-0:0. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [92/92] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/93] libzstd-0:1.5.6-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [93/93] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/94] file-libs-0:5.45-8.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [94/94] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/95] libxml2-0:2.12.8-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [95/95] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/96] lz4-libs-0:1.10.0-1.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [96/96] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/97] curl-0:8.11.1-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [97/97] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/98] lua-libs-0:5.4.7-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [98/98] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/99] rpm-sequoia-0:1.7.0-3.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [99/99] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/100] sqlite-libs-0:3.47.2-1.fc42.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [100/100] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/101] ncurses-base-0:6.5-2.20240629 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [101/101] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/102] ca-certificates-0:2024.2.69_v 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [102/102] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/103] crypto-policies-0:20241128-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [103/103] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/104] pcre2-syntax-0:10.44-1.fc41.1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [104/104] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/105] fedora-gpg-keys-0:42-0.3.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [105/105] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/106] fedora-repos-rawhide-0:42-0.3 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [106/106] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/107] add-determinism-0:0.4.3-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [107/107] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/108] elfutils-default-yama-scope-0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [108/108] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/109] json-c-0:0.18-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [109/109] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/110] libgcc-0:15.0.0-0.2.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [110/110] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/111] pam-0:1.7.0-3.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [111/111] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/112] p11-kit-trust-0:0.25.5-4.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [112/112] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/113] p11-kit-0:0.25.5-4.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [113/113] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/114] libffi-0:3.4.6-3.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [114/114] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/115] pkgconf-pkg-config-0:2.3.0-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [115/115] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/116] gdbm-1:1.23-7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [116/116] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/117] gdbm-libs-1:1.23-7.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [117/117] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/118] libnsl2-0:2.0.1-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [118/118] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/119] libpwquality-0:1.4.5-11.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [119/119] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/120] libtirpc-0:1.3.6-1.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [120/120] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/121] alternatives-0:1.30-1.fc41.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [121/121] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/122] libtasn1-0:4.19.0-9.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [122/122] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/123] pkgconf-0:2.3.0-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [123/123] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/124] pkgconf-m4-0:2.3.0-1.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [124/124] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/125] cracklib-0:2.9.11-6.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [125/125] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/126] krb5-libs-0:1.21.3-3.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [126/126] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/127] libcom_err-0:1.47.1-6.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [127/127] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/128] libpkgconf-0:2.3.0-1.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [128/128] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/129] keyutils-libs-0:1.6.3-4.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [129/129] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/130] libverto-0:0.3.2-9.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [130/130] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/131] libstdc++-0:15.0.0-0.2.fc42.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [131/131] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/132] audit-libs-0:4.0.2-1.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [132/132] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/133] authselect-libs-0:1.5.0-8.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [133/133] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/134] libacl-0:2.3.2-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [134/134] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/135] libgomp-0:15.0.0-0.2.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [135/135] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/136] binutils-0:2.43.50-9.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [136/136] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/137] jansson-0:2.14-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [137/137] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/138] authselect-0:1.5.0-8.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [138/138] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/139] fedora-release-0:42-0.11.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [139/139] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/140] gdb-minimal-0:15.2-4.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [140/140] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/141] xxhash-libs-0:0.8.2-4.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [141/141] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/142] fedora-release-identity-basic 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [142/142] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/143] libcurl-0:8.11.1-2.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [143/143] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/144] libbrotli-0:1.1.0-5.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [144/144] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/145] libidn2-0:2.3.7-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [145/145] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/146] libnghttp2-0:1.64.0-1.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [146/146] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/147] libpsl-0:0.21.5-4.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [147/147] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/148] libssh-0:0.11.1-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [148/148] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/149] openldap-0:2.6.8-6.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [149/149] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/150] libunistring-0:1.1-8.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [150/150] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/151] publicsuffix-list-dafsa-0:202 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [151/151] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/152] libssh-config-0:0.11.1-1.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [152/152] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/153] cyrus-sasl-lib-0:2.1.28-27.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [153/153] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/154] libevent-0:2.1.12-14.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [154/154] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/155] libtool-ltdl-0:2.5.4-1.fc42.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [155/155] Total 100% | 0.0 B/s | 0.0 B | 00m00s Running transaction Importing OpenPGP key 0x105EF944: UserID : "Fedora (42) " Fingerprint: B0F4950458F69E1150C6C5EDC8AC4916105EF944 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-42-primary The key was successfully imported. Importing OpenPGP key 0x105EF944: UserID : "Fedora (42) " Fingerprint: B0F4950458F69E1150C6C5EDC8AC4916105EF944 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-42-primary The key was successfully imported. Importing OpenPGP key 0xE99D6AD1: UserID : "Fedora (41) " Fingerprint: 466CF2D8B60BC3057AA9453ED0622462E99D6AD1 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-41-primary The key was successfully imported. Importing OpenPGP key 0x31645531: UserID : "Fedora (43) " Fingerprint: C6E7F081CF80E13146676E88829B606631645531 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-43-primary The key was successfully imported. [ 1/157] Verify package files 100% | 856.0 B/s | 155.0 B | 00m00s >>> Running pre-transaction scriptlet: filesystem-0:3.18-29.fc42.x86_64 >>> Finished pre-transaction scriptlet: filesystem-0:3.18-29.fc42.x86_64 >>> [RPM] /var/lib/mock/fedora-rawhide-x86_64-1734557438.910773/root/var/cache/d [ 2/157] Prepare transaction 100% | 3.6 KiB/s | 155.0 B | 00m00s [ 3/157] Installing libgcc-0:15.0.0-0. 100% | 131.2 MiB/s | 268.6 KiB | 00m00s [ 4/157] Installing libssh-config-0:0. 100% | 0.0 B/s | 816.0 B | 00m00s [ 5/157] Installing publicsuffix-list- 100% | 0.0 B/s | 68.3 KiB | 00m00s [ 6/157] Installing fedora-release-ide 100% | 0.0 B/s | 976.0 B | 00m00s [ 7/157] Installing fedora-gpg-keys-0: 100% | 42.0 MiB/s | 172.2 KiB | 00m00s [ 8/157] Installing fedora-repos-rawhi 100% | 0.0 B/s | 2.4 KiB | 00m00s [ 9/157] Installing fedora-repos-0:42- 100% | 0.0 B/s | 5.7 KiB | 00m00s [ 10/157] Installing fedora-release-com 100% | 23.6 MiB/s | 24.1 KiB | 00m00s [ 11/157] Installing fedora-release-0:4 100% | 0.0 B/s | 124.0 B | 00m00s [ 12/157] Installing setup-0:2.15.0-5.f 100% | 54.5 MiB/s | 726.1 KiB | 00m00s >>> [RPM] /etc/hosts created as /etc/hosts.rpmnew [ 13/157] Installing filesystem-0:3.18- 100% | 3.3 MiB/s | 212.6 KiB | 00m00s [ 14/157] Installing basesystem-0:11-21 100% | 0.0 B/s | 124.0 B | 00m00s [ 15/157] Installing pkgconf-m4-0:2.3.0 100% | 0.0 B/s | 14.8 KiB | 00m00s [ 16/157] Installing pcre2-syntax-0:10. 100% | 248.1 MiB/s | 254.1 KiB | 00m00s [ 17/157] Installing ncurses-base-0:6.5 100% | 85.9 MiB/s | 351.7 KiB | 00m00s [ 18/157] Installing glibc-minimal-lang 100% | 0.0 B/s | 124.0 B | 00m00s [ 19/157] Installing ncurses-libs-0:6.5 100% | 191.8 MiB/s | 981.8 KiB | 00m00s [ 20/157] Installing glibc-0:2.40.9000- 100% | 266.9 MiB/s | 6.7 MiB | 00m00s [ 21/157] Installing bash-0:5.2.37-1.fc 100% | 389.0 MiB/s | 8.2 MiB | 00m00s [ 22/157] Installing glibc-common-0:2.4 100% | 173.6 MiB/s | 1.0 MiB | 00m00s [ 23/157] Installing glibc-gconv-extra- 100% | 269.2 MiB/s | 8.1 MiB | 00m00s [ 24/157] Installing zlib-ng-compat-0:2 100% | 131.7 MiB/s | 134.9 KiB | 00m00s [ 25/157] Installing bzip2-libs-0:1.0.8 100% | 79.9 MiB/s | 81.8 KiB | 00m00s [ 26/157] Installing xz-libs-1:5.6.3-2. 100% | 214.3 MiB/s | 219.5 KiB | 00m00s [ 27/157] Installing popt-0:1.19-7.fc41 100% | 70.1 MiB/s | 143.5 KiB | 00m00s [ 28/157] Installing readline-0:8.2-11. 100% | 241.8 MiB/s | 495.3 KiB | 00m00s [ 29/157] Installing libuuid-0:2.40.2-8 100% | 41.5 MiB/s | 42.5 KiB | 00m00s [ 30/157] Installing libblkid-0:2.40.2- 100% | 257.5 MiB/s | 263.6 KiB | 00m00s [ 31/157] Installing gmp-1:6.3.0-2.fc41 100% | 397.3 MiB/s | 813.7 KiB | 00m00s [ 32/157] Installing libattr-0:2.5.2-4. 100% | 0.0 B/s | 29.5 KiB | 00m00s [ 33/157] Installing libacl-0:2.3.2-2.f 100% | 0.0 B/s | 39.2 KiB | 00m00s [ 34/157] Installing libxcrypt-0:4.4.36 100% | 267.7 MiB/s | 274.1 KiB | 00m00s [ 35/157] Installing libzstd-0:1.5.6-2. 100% | 389.3 MiB/s | 797.2 KiB | 00m00s [ 36/157] Installing elfutils-libelf-0: 100% | 389.0 MiB/s | 1.2 MiB | 00m00s [ 37/157] Installing libstdc++-0:15.0.0 100% | 343.8 MiB/s | 2.8 MiB | 00m00s [ 38/157] Installing libeconf-0:0.7.5-1 100% | 66.8 MiB/s | 68.4 KiB | 00m00s [ 39/157] Installing gdbm-libs-1:1.23-7 100% | 120.7 MiB/s | 123.6 KiB | 00m00s [ 40/157] Installing dwz-0:0.15-8.fc42. 100% | 293.5 MiB/s | 300.6 KiB | 00m00s [ 41/157] Installing mpfr-0:4.2.1-5.fc4 100% | 271.4 MiB/s | 833.7 KiB | 00m00s [ 42/157] Installing gawk-0:5.3.0-4.fc4 100% | 288.7 MiB/s | 1.7 MiB | 00m00s [ 43/157] Installing unzip-0:6.0-65.fc4 100% | 196.2 MiB/s | 401.7 KiB | 00m00s [ 44/157] Installing file-libs-0:5.45-8 100% | 662.6 MiB/s | 9.9 MiB | 00m00s [ 45/157] Installing file-0:5.45-8.fc42 100% | 14.7 MiB/s | 105.2 KiB | 00m00s [ 46/157] Installing crypto-policies-0: 100% | 32.0 MiB/s | 163.7 KiB | 00m00s [ 47/157] Installing pcre2-0:10.44-1.fc 100% | 319.8 MiB/s | 654.9 KiB | 00m00s [ 48/157] Installing grep-0:3.11-9.fc41 100% | 200.7 MiB/s | 1.0 MiB | 00m00s [ 49/157] Installing xz-1:5.6.3-2.fc42. 100% | 247.4 MiB/s | 1.2 MiB | 00m00s [ 50/157] Installing libcap-ng-0:0.8.5- 100% | 69.4 MiB/s | 71.0 KiB | 00m00s [ 51/157] Installing audit-libs-0:4.0.2 100% | 325.6 MiB/s | 333.4 KiB | 00m00s [ 52/157] Installing pam-libs-0:1.7.0-3 100% | 138.5 MiB/s | 141.8 KiB | 00m00s [ 53/157] Installing libcap-0:2.71-1.fc 100% | 105.4 MiB/s | 215.8 KiB | 00m00s [ 54/157] Installing systemd-libs-0:257 100% | 317.2 MiB/s | 2.2 MiB | 00m00s [ 55/157] Installing libsmartcols-0:2.4 100% | 177.1 MiB/s | 181.4 KiB | 00m00s [ 56/157] Installing libsepol-0:3.8-0.r 100% | 401.9 MiB/s | 823.0 KiB | 00m00s [ 57/157] Installing libselinux-0:3.8-0 100% | 188.4 MiB/s | 192.9 KiB | 00m00s [ 58/157] Installing sed-0:4.9-3.fc41.x 100% | 212.3 MiB/s | 869.7 KiB | 00m00s [ 59/157] Installing findutils-1:4.10.0 100% | 309.7 MiB/s | 1.9 MiB | 00m00s [ 60/157] Installing libmount-0:2.40.2- 100% | 348.6 MiB/s | 356.9 KiB | 00m00s [ 61/157] Installing lz4-libs-0:1.10.0- 100% | 143.1 MiB/s | 146.6 KiB | 00m00s [ 62/157] Installing lua-libs-0:5.4.7-1 100% | 279.5 MiB/s | 286.2 KiB | 00m00s [ 63/157] Installing libffi-0:3.4.6-3.f 100% | 85.7 MiB/s | 87.8 KiB | 00m00s [ 64/157] Installing alternatives-0:1.3 100% | 66.3 MiB/s | 67.9 KiB | 00m00s [ 65/157] Installing libtasn1-0:4.19.0- 100% | 173.3 MiB/s | 177.5 KiB | 00m00s [ 66/157] Installing p11-kit-0:0.25.5-4 100% | 246.2 MiB/s | 2.2 MiB | 00m00s [ 67/157] Installing libcom_err-0:1.47. 100% | 66.7 MiB/s | 68.3 KiB | 00m00s [ 68/157] Installing libunistring-0:1.1 100% | 346.1 MiB/s | 1.7 MiB | 00m00s [ 69/157] Installing libidn2-0:2.3.7-2. 100% | 163.6 MiB/s | 335.1 KiB | 00m00s [ 70/157] Installing libpsl-0:0.21.5-4. 100% | 79.7 MiB/s | 81.7 KiB | 00m00s [ 71/157] Installing p11-kit-trust-0:0. 100% | 49.5 MiB/s | 405.5 KiB | 00m00s [ 72/157] Installing zstd-0:1.5.6-2.fc4 100% | 338.3 MiB/s | 1.7 MiB | 00m00s [ 73/157] Installing util-linux-core-0: 100% | 218.3 MiB/s | 1.5 MiB | 00m00s [ 74/157] Installing tar-2:1.35-4.fc41. 100% | 328.7 MiB/s | 3.0 MiB | 00m00s [ 75/157] Installing libsemanage-0:3.8- 100% | 149.9 MiB/s | 307.1 KiB | 00m00s [ 76/157] Installing shadow-utils-2:4.1 100% | 228.9 MiB/s | 4.1 MiB | 00m00s [ 77/157] Installing zip-0:3.0-42.fc42. 100% | 341.7 MiB/s | 699.8 KiB | 00m00s [ 78/157] Installing gdbm-1:1.23-7.fc41 100% | 227.4 MiB/s | 465.8 KiB | 00m00s [ 79/157] Installing cyrus-sasl-lib-0:2 100% | 329.4 MiB/s | 2.3 MiB | 00m00s [ 80/157] Installing libfdisk-0:2.40.2- 100% | 355.5 MiB/s | 364.0 KiB | 00m00s [ 81/157] Installing libxml2-0:2.12.8-2 100% | 342.4 MiB/s | 1.7 MiB | 00m00s [ 82/157] Installing bzip2-0:1.0.8-19.f 100% | 97.8 MiB/s | 100.2 KiB | 00m00s [ 83/157] Installing sqlite-libs-0:3.47 100% | 358.5 MiB/s | 1.4 MiB | 00m00s [ 84/157] Installing add-determinism-0: 100% | 347.3 MiB/s | 2.4 MiB | 00m00s [ 85/157] Installing build-reproducibil 100% | 0.0 B/s | 1.0 KiB | 00m00s [ 86/157] Installing ed-0:1.20.2-2.fc41 100% | 145.7 MiB/s | 149.2 KiB | 00m00s [ 87/157] Installing patch-0:2.7.6-25.f 100% | 261.9 MiB/s | 268.2 KiB | 00m00s [ 88/157] Installing filesystem-srpm-ma 100% | 0.0 B/s | 36.8 KiB | 00m00s [ 89/157] Installing elfutils-default-y 100% | 408.6 KiB/s | 2.0 KiB | 00m00s [ 90/157] Installing elfutils-libs-0:0. 100% | 216.4 MiB/s | 664.7 KiB | 00m00s [ 91/157] Installing cpio-0:2.15-2.fc41 100% | 219.9 MiB/s | 1.1 MiB | 00m00s [ 92/157] Installing diffutils-0:3.10-8 100% | 318.1 MiB/s | 1.6 MiB | 00m00s [ 93/157] Installing json-c-0:0.18-1.fc 100% | 82.6 MiB/s | 84.6 KiB | 00m00s [ 94/157] Installing libpkgconf-0:2.3.0 100% | 77.5 MiB/s | 79.3 KiB | 00m00s [ 95/157] Installing pkgconf-0:2.3.0-1. 100% | 89.0 MiB/s | 91.1 KiB | 00m00s [ 96/157] Installing pkgconf-pkg-config 100% | 0.0 B/s | 1.8 KiB | 00m00s [ 97/157] Installing keyutils-libs-0:1. 100% | 0.0 B/s | 55.8 KiB | 00m00s [ 98/157] Installing libverto-0:0.3.2-9 100% | 0.0 B/s | 31.3 KiB | 00m00s [ 99/157] Installing libgomp-0:15.0.0-0 100% | 259.1 MiB/s | 530.7 KiB | 00m00s [100/157] Installing jansson-0:2.14-1.f 100% | 92.3 MiB/s | 94.5 KiB | 00m00s [101/157] Installing xxhash-libs-0:0.8. 100% | 87.7 MiB/s | 89.8 KiB | 00m00s [102/157] Installing libbrotli-0:1.1.0- 100% | 273.4 MiB/s | 839.9 KiB | 00m00s [103/157] Installing libnghttp2-0:1.64. 100% | 171.5 MiB/s | 175.6 KiB | 00m00s [104/157] Installing libtool-ltdl-0:2.5 100% | 67.6 MiB/s | 69.2 KiB | 00m00s [105/157] Installing rust-srpm-macros-0 100% | 0.0 B/s | 5.6 KiB | 00m00s [106/157] Installing qt6-srpm-macros-0: 100% | 0.0 B/s | 732.0 B | 00m00s [107/157] Installing qt5-srpm-macros-0: 100% | 0.0 B/s | 776.0 B | 00m00s [108/157] Installing perl-srpm-macros-0 100% | 0.0 B/s | 1.1 KiB | 00m00s [109/157] Installing package-notes-srpm 100% | 0.0 B/s | 2.0 KiB | 00m00s [110/157] Installing openblas-srpm-macr 100% | 0.0 B/s | 392.0 B | 00m00s [111/157] Installing ocaml-srpm-macros- 100% | 0.0 B/s | 2.2 KiB | 00m00s [112/157] Installing kernel-srpm-macros 100% | 0.0 B/s | 2.3 KiB | 00m00s [113/157] Installing gnat-srpm-macros-0 100% | 0.0 B/s | 1.3 KiB | 00m00s [114/157] Installing ghc-srpm-macros-0: 100% | 0.0 B/s | 1.0 KiB | 00m00s [115/157] Installing fpc-srpm-macros-0: 100% | 0.0 B/s | 420.0 B | 00m00s [116/157] Installing ansible-srpm-macro 100% | 35.4 MiB/s | 36.2 KiB | 00m00s [117/157] Installing coreutils-common-0 100% | 373.0 MiB/s | 11.2 MiB | 00m00s [118/157] Installing openssl-libs-1:3.2 100% | 391.4 MiB/s | 7.8 MiB | 00m00s [119/157] Installing coreutils-0:9.5-11 100% | 245.5 MiB/s | 5.4 MiB | 00m00s [120/157] Installing ca-certificates-0: 100% | 1.9 MiB/s | 2.4 MiB | 00m01s [121/157] Installing krb5-libs-0:1.21.3 100% | 256.1 MiB/s | 2.3 MiB | 00m00s [122/157] Installing libarchive-0:3.7.7 100% | 304.1 MiB/s | 934.2 KiB | 00m00s [123/157] Installing libtirpc-0:1.3.6-1 100% | 202.5 MiB/s | 207.3 KiB | 00m00s [124/157] Installing gzip-0:1.13-2.fc41 100% | 192.7 MiB/s | 394.6 KiB | 00m00s [125/157] Installing authselect-libs-0: 100% | 163.1 MiB/s | 835.0 KiB | 00m00s [126/157] Installing cracklib-0:2.9.11- 100% | 61.1 MiB/s | 250.3 KiB | 00m00s [127/157] Installing libpwquality-0:1.4 100% | 105.0 MiB/s | 430.1 KiB | 00m00s [128/157] Installing libnsl2-0:2.0.1-2. 100% | 57.7 MiB/s | 59.1 KiB | 00m00s [129/157] Installing pam-0:1.7.0-3.fc42 100% | 157.8 MiB/s | 1.9 MiB | 00m00s [130/157] Installing libssh-0:0.11.1-1. 100% | 279.2 MiB/s | 571.7 KiB | 00m00s [131/157] Installing rpm-sequoia-0:1.7. 100% | 332.0 MiB/s | 2.3 MiB | 00m00s [132/157] Installing rpm-libs-0:4.20.0- 100% | 236.9 MiB/s | 727.7 KiB | 00m00s [133/157] Installing rpm-build-libs-0:4 100% | 202.6 MiB/s | 207.5 KiB | 00m00s [134/157] Installing libevent-0:2.1.12- 100% | 292.8 MiB/s | 899.5 KiB | 00m00s [135/157] Installing openldap-0:2.6.8-6 100% | 212.0 MiB/s | 651.2 KiB | 00m00s [136/157] Installing libcurl-0:8.11.1-2 100% | 266.4 MiB/s | 818.4 KiB | 00m00s [137/157] Installing elfutils-debuginfo 100% | 81.8 MiB/s | 83.8 KiB | 00m00s [138/157] Installing elfutils-0:0.192-7 100% | 330.6 MiB/s | 2.6 MiB | 00m00s [139/157] Installing binutils-0:2.43.50 100% | 366.1 MiB/s | 25.6 MiB | 00m00s [140/157] Installing gdb-minimal-0:15.2 100% | 343.9 MiB/s | 12.7 MiB | 00m00s [141/157] Installing debugedit-0:5.1-2. 100% | 198.3 MiB/s | 203.0 KiB | 00m00s [142/157] Installing curl-0:8.11.1-2.fc 100% | 44.4 MiB/s | 454.5 KiB | 00m00s [143/157] Installing rpm-0:4.20.0-1.fc4 100% | 179.0 MiB/s | 2.5 MiB | 00m00s [144/157] Installing efi-srpm-macros-0: 100% | 0.0 B/s | 41.2 KiB | 00m00s [145/157] Installing lua-srpm-macros-0: 100% | 0.0 B/s | 1.9 KiB | 00m00s [146/157] Installing zig-srpm-macros-0: 100% | 0.0 B/s | 1.7 KiB | 00m00s [147/157] Installing fonts-srpm-macros- 100% | 55.7 MiB/s | 57.0 KiB | 00m00s [148/157] Installing forge-srpm-macros- 100% | 39.3 MiB/s | 40.3 KiB | 00m00s [149/157] Installing go-srpm-macros-0:3 100% | 0.0 B/s | 62.0 KiB | 00m00s [150/157] Installing python-srpm-macros 100% | 50.9 MiB/s | 52.2 KiB | 00m00s [151/157] Installing redhat-rpm-config- 100% | 94.3 MiB/s | 193.2 KiB | 00m00s [152/157] Installing rpm-build-0:4.20.0 100% | 99.1 MiB/s | 202.9 KiB | 00m00s [153/157] Installing pyproject-srpm-mac 100% | 1.2 MiB/s | 2.5 KiB | 00m00s [154/157] Installing util-linux-0:2.40. 100% | 161.5 MiB/s | 3.7 MiB | 00m00s [155/157] Installing authselect-0:1.5.0 100% | 78.3 MiB/s | 160.4 KiB | 00m00s [156/157] Installing which-0:2.21-42.fc 100% | 80.5 MiB/s | 82.4 KiB | 00m00s [157/157] Installing info-0:7.1.1-2.fc4 100% | 212.1 KiB/s | 362.2 KiB | 00m02s Warning: skipped OpenPGP checks for 10 packages from repositories: copr_base, https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch Complete! Finish: installing minimal buildroot with dnf5 Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: add-determinism-0.4.3-1.fc42.x86_64 alternatives-1.30-1.fc41.x86_64 ansible-srpm-macros-1-16.fc41.noarch audit-libs-4.0.2-1.fc42.x86_64 authselect-1.5.0-8.fc42.x86_64 authselect-libs-1.5.0-8.fc42.x86_64 basesystem-11-21.fc41.noarch bash-5.2.37-1.fc42.x86_64 binutils-2.43.50-9.fc42.x86_64 build-reproducibility-srpm-macros-0.4.3-1.fc42.noarch bzip2-1.0.8-19.fc41.x86_64 bzip2-libs-1.0.8-19.fc41.x86_64 ca-certificates-2024.2.69_v8.0.401-3.fc42.noarch coreutils-9.5-11.fc42.x86_64 coreutils-common-9.5-11.fc42.x86_64 cpio-2.15-2.fc41.x86_64 cracklib-2.9.11-6.fc41.x86_64 crypto-policies-20241128-1.gitbb7b0b0.fc42.noarch curl-8.11.1-2.fc42.x86_64 cyrus-sasl-lib-2.1.28-27.fc41.x86_64 debugedit-5.1-2.fc42.x86_64 diffutils-3.10-8.fc41.x86_64 dwz-0.15-8.fc42.x86_64 ed-1.20.2-2.fc41.x86_64 efi-srpm-macros-5-13.fc42.noarch elfutils-0.192-7.fc42.x86_64 elfutils-debuginfod-client-0.192-7.fc42.x86_64 elfutils-default-yama-scope-0.192-7.fc42.noarch elfutils-libelf-0.192-7.fc42.x86_64 elfutils-libs-0.192-7.fc42.x86_64 fedora-gpg-keys-42-0.3.noarch fedora-release-42-0.11.noarch fedora-release-common-42-0.11.noarch fedora-release-identity-basic-42-0.11.noarch fedora-repos-42-0.3.noarch fedora-repos-rawhide-42-0.3.noarch file-5.45-8.fc42.x86_64 file-libs-5.45-8.fc42.x86_64 filesystem-3.18-29.fc42.x86_64 filesystem-srpm-macros-3.18-29.fc42.noarch findutils-4.10.0-4.fc41.x86_64 fonts-srpm-macros-2.0.5-17.fc41.noarch forge-srpm-macros-0.4.0-1.fc42.noarch fpc-srpm-macros-1.3-13.fc41.noarch gawk-5.3.0-4.fc41.x86_64 gdb-minimal-15.2-4.fc42.x86_64 gdbm-1.23-7.fc41.x86_64 gdbm-libs-1.23-7.fc41.x86_64 ghc-srpm-macros-1.9.2-1.fc42.noarch glibc-2.40.9000-24.fc42.x86_64 glibc-common-2.40.9000-24.fc42.x86_64 glibc-gconv-extra-2.40.9000-24.fc42.x86_64 glibc-minimal-langpack-2.40.9000-24.fc42.x86_64 gmp-6.3.0-2.fc41.x86_64 gnat-srpm-macros-6-6.fc41.noarch go-srpm-macros-3.6.0-5.fc42.noarch gpg-pubkey-105ef944-65ca83d1 gpg-pubkey-31645531-66b6dccf gpg-pubkey-e99d6ad1-64d2612c grep-3.11-9.fc41.x86_64 gzip-1.13-2.fc41.x86_64 info-7.1.1-2.fc42.x86_64 jansson-2.14-1.fc42.x86_64 json-c-0.18-1.fc42.x86_64 kernel-srpm-macros-1.0-24.fc41.noarch keyutils-libs-1.6.3-4.fc41.x86_64 krb5-libs-1.21.3-3.fc42.x86_64 libacl-2.3.2-2.fc42.x86_64 libarchive-3.7.7-1.fc42.x86_64 libattr-2.5.2-4.fc41.x86_64 libblkid-2.40.2-8.fc42.x86_64 libbrotli-1.1.0-5.fc41.x86_64 libcap-2.71-1.fc42.x86_64 libcap-ng-0.8.5-3.fc41.x86_64 libcom_err-1.47.1-6.fc42.x86_64 libcurl-8.11.1-2.fc42.x86_64 libeconf-0.7.5-1.fc42.x86_64 libevent-2.1.12-14.fc41.x86_64 libfdisk-2.40.2-8.fc42.x86_64 libffi-3.4.6-3.fc42.x86_64 libgcc-15.0.0-0.2.fc42.x86_64 libgomp-15.0.0-0.2.fc42.x86_64 libidn2-2.3.7-2.fc41.x86_64 libmount-2.40.2-8.fc42.x86_64 libnghttp2-1.64.0-1.fc42.x86_64 libnsl2-2.0.1-2.fc41.x86_64 libpkgconf-2.3.0-1.fc42.x86_64 libpsl-0.21.5-4.fc41.x86_64 libpwquality-1.4.5-11.fc41.x86_64 libselinux-3.8-0.rc1.2.fc42.x86_64 libsemanage-3.8-0.rc1.1.fc42.x86_64 libsepol-3.8-0.rc1.1.fc42.x86_64 libsmartcols-2.40.2-8.fc42.x86_64 libssh-0.11.1-1.fc42.x86_64 libssh-config-0.11.1-1.fc42.noarch libstdc++-15.0.0-0.2.fc42.x86_64 libtasn1-4.19.0-9.fc41.x86_64 libtirpc-1.3.6-1.fc42.x86_64 libtool-ltdl-2.5.4-1.fc42.x86_64 libunistring-1.1-8.fc41.x86_64 libuuid-2.40.2-8.fc42.x86_64 libverto-0.3.2-9.fc41.x86_64 libxcrypt-4.4.36-11.fc42.x86_64 libxml2-2.12.8-2.fc41.x86_64 libzstd-1.5.6-2.fc41.x86_64 lua-libs-5.4.7-1.fc42.x86_64 lua-srpm-macros-1-14.fc41.noarch lz4-libs-1.10.0-1.fc41.x86_64 mpfr-4.2.1-5.fc41.x86_64 ncurses-base-6.5-2.20240629.fc41.noarch ncurses-libs-6.5-2.20240629.fc41.x86_64 ocaml-srpm-macros-10-3.fc41.noarch openblas-srpm-macros-2-18.fc41.noarch openldap-2.6.8-6.fc42.x86_64 openssl-libs-3.2.2-8.fc42.x86_64 p11-kit-0.25.5-4.fc42.x86_64 p11-kit-trust-0.25.5-4.fc42.x86_64 package-notes-srpm-macros-0.5-12.fc41.noarch pam-1.7.0-3.fc42.x86_64 pam-libs-1.7.0-3.fc42.x86_64 patch-2.7.6-25.fc41.x86_64 pcre2-10.44-1.fc41.1.x86_64 pcre2-syntax-10.44-1.fc41.1.noarch perl-srpm-macros-1-56.fc41.noarch pkgconf-2.3.0-1.fc42.x86_64 pkgconf-m4-2.3.0-1.fc42.noarch pkgconf-pkg-config-2.3.0-1.fc42.x86_64 popt-1.19-7.fc41.x86_64 publicsuffix-list-dafsa-20240107-4.fc41.noarch pyproject-srpm-macros-1.16.3-1.fc42.noarch python-srpm-macros-3.13-3.fc41.noarch qt5-srpm-macros-5.15.15-1.fc42.noarch qt6-srpm-macros-6.8.1-4.fc42.noarch readline-8.2-11.fc42.x86_64 redhat-rpm-config-300-1.no_annobin.0.fc42.noarch rpm-4.20.0-1.fc42.x86_64 rpm-build-4.20.0-1.fc42.x86_64 rpm-build-libs-4.20.0-1.fc42.x86_64 rpm-libs-4.20.0-1.fc42.x86_64 rpm-sequoia-1.7.0-3.fc42.x86_64 rust-srpm-macros-26.3-3.fc42.noarch sed-4.9-3.fc41.x86_64 setup-2.15.0-5.fc41.noarch shadow-utils-4.17.0~rc1-1.fc42.x86_64 sqlite-libs-3.47.2-1.fc42.x86_64 systemd-libs-257-1.fc42.x86_64 tar-1.35-4.fc41.x86_64 unzip-6.0-65.fc42.x86_64 util-linux-2.40.2-8.fc42.x86_64 util-linux-core-2.40.2-8.fc42.x86_64 which-2.21-42.fc41.x86_64 xxhash-libs-0.8.2-4.fc42.x86_64 xz-5.6.3-2.fc42.x86_64 xz-libs-5.6.3-2.fc42.x86_64 zig-srpm-macros-1-3.fc41.noarch zip-3.0-42.fc42.x86_64 zlib-ng-compat-2.2.2-1.fc42.x86_64 zstd-1.5.6-2.fc41.x86_64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1721174400 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-5.fc42.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1734557438.910773/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-erhq4byq/bowtie/bowtie.spec) Config(child) 0 minutes 15 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-5.fc42.src.rpm) Config(fedora-rawhide-x86_64) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1734557438.910773/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1734557438.910773/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1734557438.910773/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.20.0-1.fc42.x86_64 rpm-sequoia-1.7.0-3.fc42.x86_64 dnf5-5.2.8.1-2.fc42.x86_64 dnf5-plugins-5.2.8.1-2.fc42.x86_64 Finish: chroot init Start: build phase for bowtie-1.3.1-5.fc42.src.rpm Start: build setup for bowtie-1.3.1-5.fc42.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1721174400 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-5.fc42.src.rpm Updating and loading repositories: fedora 100% | 1.0 MiB/s | 26.0 KiB | 00m00s Additional repo https_fedorapeople_org 100% | 24.2 KiB/s | 1.5 KiB | 00m00s Copr repository 100% | 109.4 KiB/s | 1.5 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing: gcc-c++ x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 40.7 MiB hostname x86_64 3.25-1.fc42 fedora 45.6 KiB make x86_64 1:4.4.1-9.fc42 fedora 1.8 MiB perl-Clone x86_64 0.47-1.fc42 fedora 36.5 KiB perl-Data-Dumper x86_64 2.189-512.fc41 fedora 111.7 KiB perl-FindBin noarch 1.54-512.fc42 fedora 6.7 KiB perl-Getopt-Long noarch 1:2.58-2.fc41 fedora 144.5 KiB perl-Test-Deep noarch 1.204-6.fc41 fedora 264.1 KiB perl-interpreter x86_64 4:5.40.0-512.fc42 fedora 122.3 KiB perl-lib x86_64 0.65-512.fc42 fedora 8.5 KiB python3 x86_64 3.13.1-2.fc42 fedora 30.6 KiB tbb-devel x86_64 2022.0.0-2.fc42 fedora 1.4 MiB zlib-ng-compat-devel x86_64 2.2.2-1.fc42 fedora 106.8 KiB Installing dependencies: annobin-docs noarch 12.79-1.fc42 copr_base 98.6 KiB annobin-plugin-gcc x86_64 12.79-1.fc42 copr_base 989.3 KiB cmake-filesystem x86_64 3.31.2-1.fc42 fedora 0.0 B cpp x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 37.5 MiB expat x86_64 2.6.4-1.fc42 fedora 285.5 KiB gcc x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 109.9 MiB gcc-plugin-annobin x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 59.6 KiB glibc-devel x86_64 2.40.9000-24.fc42 fedora 2.3 MiB groff-base x86_64 1.23.0-7.fc41 fedora 3.8 MiB hwloc-libs x86_64 2.11.2-1.fc42 fedora 2.9 MiB kernel-headers x86_64 6.13.0-0.rc3.29.fc42 fedora 6.5 MiB libb2 x86_64 0.98.1-12.fc41 fedora 42.2 KiB libmpc x86_64 1.3.1-6.fc41 fedora 164.7 KiB libstdc++-devel x86_64 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 15.7 MiB libxcrypt-devel x86_64 4.4.36-11.fc42 fedora 30.5 KiB mpdecimal x86_64 2.5.1-16.fc41 fedora 204.9 KiB ncurses x86_64 6.5-2.20240629.fc41 fedora 627.3 KiB perl-AutoLoader noarch 5.74-512.fc42 fedora 20.5 KiB perl-B x86_64 1.89-512.fc42 fedora 498.0 KiB perl-Carp noarch 1.54-511.fc41 fedora 46.6 KiB perl-Class-Struct noarch 0.68-512.fc42 fedora 25.4 KiB perl-Digest noarch 1.20-511.fc41 fedora 35.3 KiB perl-Digest-MD5 x86_64 2.59-5.fc41 fedora 59.8 KiB perl-DynaLoader x86_64 1.56-512.fc42 fedora 32.1 KiB perl-Encode x86_64 4:3.21-511.fc41 fedora 4.7 MiB perl-Errno x86_64 1.38-512.fc42 fedora 8.4 KiB perl-Exporter noarch 5.78-511.fc41 fedora 54.3 KiB perl-Fcntl x86_64 1.18-512.fc42 fedora 49.0 KiB perl-File-Basename noarch 2.86-512.fc42 fedora 14.0 KiB perl-File-Path noarch 2.18-511.fc41 fedora 63.5 KiB perl-File-Temp noarch 1:0.231.100-511.fc41 fedora 162.3 KiB perl-File-stat noarch 1.14-512.fc42 fedora 12.5 KiB perl-FileHandle noarch 2.05-512.fc42 fedora 9.3 KiB perl-Getopt-Std noarch 1.14-512.fc42 fedora 11.2 KiB perl-HTTP-Tiny noarch 0.090-1.fc42 fedora 154.4 KiB perl-IO x86_64 1.55-512.fc42 fedora 151.1 KiB perl-IO-Socket-IP noarch 0.43-1.fc42 fedora 100.3 KiB perl-IO-Socket-SSL noarch 2.089-1.fc42 fedora 703.3 KiB perl-IPC-Open3 noarch 1.22-512.fc42 fedora 22.5 KiB perl-JSON-PP noarch 1:4.16-512.fc41 fedora 141.8 KiB perl-MIME-Base32 noarch 1.303-21.fc41 fedora 30.7 KiB perl-MIME-Base64 x86_64 3.16-511.fc41 fedora 46.1 KiB perl-Math-BigInt noarch 1:2.0030.03-3.fc41 fedora 957.7 KiB perl-Math-Complex noarch 1.62-512.fc42 fedora 85.0 KiB perl-Net-SSLeay x86_64 1.94-7.fc41 fedora 1.3 MiB perl-POSIX x86_64 2.20-512.fc42 fedora 235.1 KiB perl-PathTools x86_64 3.91-511.fc41 fedora 180.0 KiB perl-Pod-Escapes noarch 1:1.07-511.fc41 fedora 24.9 KiB perl-Pod-Perldoc noarch 3.28.01-512.fc41 fedora 163.7 KiB perl-Pod-Simple noarch 1:3.45-511.fc41 fedora 560.9 KiB perl-Pod-Usage noarch 4:2.03-511.fc41 fedora 84.8 KiB perl-Scalar-List-Utils x86_64 5:1.68-1.fc42 fedora 148.9 KiB perl-SelectSaver noarch 1.02-512.fc42 fedora 2.2 KiB perl-Socket x86_64 4:2.038-511.fc41 fedora 124.0 KiB perl-Storable x86_64 1:3.32-511.fc41 fedora 232.4 KiB perl-Symbol noarch 1.09-512.fc42 fedora 6.8 KiB perl-Term-ANSIColor noarch 5.01-512.fc41 fedora 97.5 KiB perl-Term-Cap noarch 1.18-511.fc41 fedora 29.3 KiB perl-Term-Table noarch 0.023-2.fc42 fedora 77.7 KiB perl-Test-Simple noarch 3:1.302204-1.fc42 fedora 1.7 MiB perl-Text-ParseWords noarch 3.31-511.fc41 fedora 13.6 KiB perl-Text-Tabs+Wrap noarch 2024.001-511.fc41 fedora 22.6 KiB perl-Time-HiRes x86_64 4:1.9777-511.fc41 fedora 119.9 KiB perl-Time-Local noarch 2:1.350-511.fc41 fedora 69.0 KiB perl-URI noarch 5.31-1.fc42 fedora 257.0 KiB perl-base noarch 2.27-512.fc42 fedora 12.5 KiB perl-constant noarch 1.33-512.fc41 fedora 26.2 KiB perl-if noarch 0.61.000-512.fc42 fedora 5.8 KiB perl-libnet noarch 3.15-512.fc41 fedora 289.4 KiB perl-libs x86_64 4:5.40.0-512.fc42 fedora 9.9 MiB perl-locale noarch 1.12-512.fc42 fedora 6.5 KiB perl-mro x86_64 1.29-512.fc42 fedora 45.6 KiB perl-overload noarch 1.37-512.fc42 fedora 71.5 KiB perl-overloading noarch 0.02-512.fc42 fedora 4.8 KiB perl-parent noarch 1:0.244-1.fc42 fedora 10.3 KiB perl-podlators noarch 1:6.0.2-2.fc41 fedora 317.5 KiB perl-threads x86_64 1:2.40-511.fc41 fedora 115.1 KiB perl-vars noarch 1.05-512.fc42 fedora 3.9 KiB python-pip-wheel noarch 24.3.1-1.fc42 fedora 1.2 MiB python3-libs x86_64 3.13.1-2.fc42 fedora 39.8 MiB tbb x86_64 2022.0.0-2.fc42 fedora 437.1 KiB tbb-bind x86_64 2022.0.0-2.fc42 fedora 22.4 KiB tzdata noarch 2024b-1.fc42 fedora 1.6 MiB Transaction Summary: Installing: 96 packages Total size of inbound packages is 95 MiB. Need to download 2 MiB. After this operation, 293 MiB extra will be used (install 293 MiB, remove 0 B). [1/2] make-1:4.4.1-9.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [2/4] perl-Data-Dumper-0:2.189-512.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [3/6] perl-Getopt-Long-1:2.58-2.fc41.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [4/9] perl-interpreter-4:5.40.0-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/10] gcc-c++-0:15.0.0-0.2.fc42.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/11] python3-0:3.13.1-2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/13] zlib-ng-compat-devel-0:2.2.2-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/14] perl-AutoLoader-0:5.74-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/15] perl-Exporter-0:5.78-511.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [10/16] perl-libs-4:5.40.0-512.fc42.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [11/17] perl-B-0:1.89-512.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [12/18] perl-Carp-0:1.54-511.fc41.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [13/19] perl-Scalar-List-Utils-5:1.68-1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [14/20] perl-constant-0:1.33-512.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [15/21] perl-File-Basename-0:2.86-512.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [16/22] perl-PathTools-0:3.91-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [17/23] perl-Pod-Usage-4:2.03-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [18/24] perl-Text-ParseWords-0:3.31-511 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [19/25] perl-base-0:2.27-512.fc42.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [20/26] perl-overload-0:1.37-512.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [21/28] libmpc-0:1.3.1-6.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [22/29] gcc-0:15.0.0-0.2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [23/30] libstdc++-devel-0:15.0.0-0.2.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [24/31] python3-libs-0:3.13.1-2.fc42.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [25/32] cmake-filesystem-0:3.31.2-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [26/35] perl-DynaLoader-0:1.56-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [27/36] perl-if-0:0.61.000-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [28/37] perl-overloading-0:0.02-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [29/38] perl-Errno-0:1.38-512.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [30/39] perl-Pod-Perldoc-0:3.28.01-512. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [31/40] perl-podlators-1:6.0.2-2.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [32/41] perl-mro-0:1.29-512.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [33/42] perl-File-Temp-1:0.231.100-511. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [34/43] perl-IO-0:1.55-512.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [35/45] perl-POSIX-0:2.20-512.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [36/46] perl-Storable-1:3.32-511.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [37/47] perl-Symbol-0:1.09-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [38/48] perl-Term-ANSIColor-0:5.01-512. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [39/52] perl-vars-0:1.05-512.fc42.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [40/53] cpp-0:15.0.0-0.2.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [41/54] expat-0:2.6.4-1.fc42.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [42/55] libb2-0:0.98.1-12.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [43/56] mpdecimal-0:2.5.1-16.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [44/57] python-pip-wheel-0:24.3.1-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [45/58] tzdata-0:2024b-1.fc42.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [46/59] hwloc-libs-0:2.11.2-1.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [47/60] groff-base-0:1.23.0-7.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [48/61] perl-Fcntl-0:1.18-512.fc42.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [49/62] perl-HTTP-Tiny-0:0.090-1.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [50/63] perl-IPC-Open3-0:1.22-512.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [51/64] perl-Pod-Simple-1:3.45-511.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [52/65] perl-parent-1:0.244-1.fc42.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [53/66] perl-Term-Cap-0:1.18-511.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [54/67] perl-File-Path-0:2.18-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [55/68] perl-File-stat-0:1.14-512.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [56/69] perl-SelectSaver-0:1.02-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [57/70] perl-Socket-4:2.038-511.fc41.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [58/72] perl-locale-0:1.12-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [59/73] perl-IO-Socket-SSL-0:2.089-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [60/74] perl-MIME-Base64-0:3.16-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [61/75] perl-Net-SSLeay-0:1.94-7.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [62/76] perl-Time-Local-2:1.350-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [63/77] perl-Pod-Escapes-1:1.07-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [64/78] perl-Text-Tabs+Wrap-0:2024.001- 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [65/79] ncurses-0:6.5-2.20240629.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [66/80] perl-Class-Struct-0:0.68-512.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [67/82] perl-IO-Socket-IP-0:0.43-1.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [68/83] perl-URI-0:5.31-1.fc42.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [69/84] perl-MIME-Base32-0:1.303-21.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [70/85] perl-libnet-0:3.15-512.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [71/86] perl-Digest-MD5-0:2.59-5.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [72/87] perl-FileHandle-0:2.05-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [73/88] perl-Digest-0:1.20-511.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [74/89] glibc-devel-0:2.40.9000-24.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [75/90] libxcrypt-devel-0:4.4.36-11.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [76/91] perl-Encode-4:3.21-511.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [77/92] perl-Getopt-Std-0:1.14-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [78/93] kernel-headers-0:6.13.0-0.rc3.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [79/94] gcc-plugin-annobin-0:15.0.0-0.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [80/95] annobin-plugin-gcc-0:12.79-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [81/96] annobin-docs-0:12.79-1.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [82/96] perl-Clone-0:0.47-1.fc42.x86_64 100% | 1.6 MiB/s | 22.3 KiB | 00m00s [83/96] hostname-0:3.25-1.fc42.x86_64 100% | 1.8 MiB/s | 27.7 KiB | 00m00s [84/96] perl-FindBin-0:1.54-512.fc42.no 100% | 886.0 KiB/s | 14.2 KiB | 00m00s [85/96] perl-lib-0:0.65-512.fc42.x86_64 100% | 7.3 MiB/s | 14.9 KiB | 00m00s [86/96] tbb-devel-0:2022.0.0-2.fc42.x86 100% | 59.8 MiB/s | 244.9 KiB | 00m00s [87/96] perl-Test-Simple-3:1.302204-1.f 100% | 168.6 MiB/s | 863.0 KiB | 00m00s [88/96] tbb-0:2022.0.0-2.fc42.x86_64 100% | 36.5 MiB/s | 149.6 KiB | 00m00s [89/96] tbb-bind-0:2022.0.0-2.fc42.x86_ 100% | 8.8 MiB/s | 18.1 KiB | 00m00s [90/96] perl-JSON-PP-1:4.16-512.fc41.no 100% | 16.1 MiB/s | 66.1 KiB | 00m00s [91/96] perl-Term-Table-0:0.023-2.fc42. 100% | 21.0 MiB/s | 42.9 KiB | 00m00s [92/96] perl-Time-HiRes-4:1.9777-511.fc 100% | 56.0 MiB/s | 57.3 KiB | 00m00s [93/96] perl-threads-1:2.40-511.fc41.x8 100% | 28.3 MiB/s | 58.0 KiB | 00m00s [94/96] perl-Math-Complex-0:1.62-512.fc 100% | 44.9 MiB/s | 46.0 KiB | 00m00s [95/96] perl-Math-BigInt-1:2.0030.03-3. 100% | 73.5 MiB/s | 225.7 KiB | 00m00s [96/96] perl-Test-Deep-0:1.204-6.fc41.n 100% | 5.0 MiB/s | 118.6 KiB | 00m00s -------------------------------------------------------------------------------- [96/96] Total 100% | 12.3 MiB/s | 1.9 MiB | 00m00s Running transaction [ 1/98] Verify package files 100% | 329.0 B/s | 96.0 B | 00m00s [ 2/98] Prepare transaction 100% | 1.9 KiB/s | 96.0 B | 00m00s [ 3/98] Installing libmpc-0:1.3.1-6.fc4 100% | 162.3 MiB/s | 166.2 KiB | 00m00s [ 4/98] Installing tbb-0:2022.0.0-2.fc4 100% | 214.9 MiB/s | 440.1 KiB | 00m00s [ 5/98] Installing cmake-filesystem-0:3 100% | 7.4 MiB/s | 7.6 KiB | 00m00s [ 6/98] Installing cpp-0:15.0.0-0.2.fc4 100% | 331.8 MiB/s | 37.5 MiB | 00m00s [ 7/98] Installing annobin-docs-0:12.79 100% | 32.5 MiB/s | 99.7 KiB | 00m00s [ 8/98] Installing kernel-headers-0:6.1 100% | 195.4 MiB/s | 6.6 MiB | 00m00s [ 9/98] Installing libxcrypt-devel-0:4. 100% | 16.0 MiB/s | 32.9 KiB | 00m00s [10/98] Installing glibc-devel-0:2.40.9 100% | 166.5 MiB/s | 2.3 MiB | 00m00s [11/98] Installing ncurses-0:6.5-2.2024 100% | 61.9 MiB/s | 633.9 KiB | 00m00s [12/98] Installing groff-base-0:1.23.0- 100% | 184.4 MiB/s | 3.9 MiB | 00m00s [13/98] Installing perl-Digest-0:1.20-5 100% | 36.2 MiB/s | 37.1 KiB | 00m00s [14/98] Installing perl-B-0:1.89-512.fc 100% | 244.8 MiB/s | 501.3 KiB | 00m00s [15/98] Installing perl-FileHandle-0:2. 100% | 0.0 B/s | 9.8 KiB | 00m00s [16/98] Installing perl-Digest-MD5-0:2. 100% | 60.2 MiB/s | 61.7 KiB | 00m00s [17/98] Installing perl-MIME-Base32-0:1 100% | 0.0 B/s | 32.2 KiB | 00m00s [18/98] Installing perl-libnet-0:3.15-5 100% | 143.9 MiB/s | 294.7 KiB | 00m00s [19/98] Installing perl-Data-Dumper-0:2 100% | 110.9 MiB/s | 113.6 KiB | 00m00s [20/98] Installing perl-AutoLoader-0:5. 100% | 0.0 B/s | 20.9 KiB | 00m00s [21/98] Installing perl-IO-Socket-IP-0: 100% | 99.8 MiB/s | 102.2 KiB | 00m00s [22/98] Installing perl-URI-0:5.31-1.fc 100% | 87.8 MiB/s | 269.6 KiB | 00m00s [23/98] Installing perl-if-0:0.61.000-5 100% | 0.0 B/s | 6.2 KiB | 00m00s [24/98] Installing perl-File-Path-0:2.1 100% | 0.0 B/s | 64.5 KiB | 00m00s [25/98] Installing perl-locale-0:1.12-5 100% | 0.0 B/s | 6.9 KiB | 00m00s [26/98] Installing perl-Net-SSLeay-0:1. 100% | 227.1 MiB/s | 1.4 MiB | 00m00s [27/98] Installing perl-Time-Local-2:1. 100% | 68.9 MiB/s | 70.6 KiB | 00m00s [28/98] Installing perl-Pod-Escapes-1:1 100% | 0.0 B/s | 25.9 KiB | 00m00s [29/98] Installing perl-Text-Tabs+Wrap- 100% | 0.0 B/s | 23.9 KiB | 00m00s [30/98] Installing perl-IO-Socket-SSL-0 100% | 345.4 MiB/s | 707.4 KiB | 00m00s [31/98] Installing perl-Term-ANSIColor- 100% | 96.9 MiB/s | 99.2 KiB | 00m00s [32/98] Installing perl-Term-Cap-0:1.18 100% | 0.0 B/s | 30.6 KiB | 00m00s [33/98] Installing perl-POSIX-0:2.20-51 100% | 230.8 MiB/s | 236.4 KiB | 00m00s [34/98] Installing perl-File-Temp-1:0.2 100% | 160.2 MiB/s | 164.1 KiB | 00m00s [35/98] Installing perl-IPC-Open3-0:1.2 100% | 0.0 B/s | 23.3 KiB | 00m00s [36/98] Installing perl-Class-Struct-0: 100% | 0.0 B/s | 25.9 KiB | 00m00s [37/98] Installing perl-Pod-Simple-1:3. 100% | 278.5 MiB/s | 570.5 KiB | 00m00s [38/98] Installing perl-HTTP-Tiny-0:0.0 100% | 152.8 MiB/s | 156.4 KiB | 00m00s [39/98] Installing perl-Symbol-0:1.09-5 100% | 0.0 B/s | 7.2 KiB | 00m00s [40/98] Installing perl-SelectSaver-0:1 100% | 0.0 B/s | 2.6 KiB | 00m00s [41/98] Installing perl-Socket-4:2.038- 100% | 123.1 MiB/s | 126.1 KiB | 00m00s [42/98] Installing perl-File-stat-0:1.1 100% | 0.0 B/s | 13.1 KiB | 00m00s [43/98] Installing perl-podlators-1:6.0 100% | 313.9 MiB/s | 321.4 KiB | 00m00s [44/98] Installing perl-Pod-Perldoc-0:3 100% | 165.3 MiB/s | 169.3 KiB | 00m00s [45/98] Installing perl-Text-ParseWords 100% | 0.0 B/s | 14.6 KiB | 00m00s [46/98] Installing perl-base-0:2.27-512 100% | 0.0 B/s | 12.9 KiB | 00m00s [47/98] Installing perl-overloading-0:0 100% | 0.0 B/s | 5.5 KiB | 00m00s [48/98] Installing perl-mro-0:1.29-512. 100% | 0.0 B/s | 46.7 KiB | 00m00s [49/98] Installing perl-Fcntl-0:1.18-51 100% | 0.0 B/s | 50.1 KiB | 00m00s [50/98] Installing perl-IO-0:1.55-512.f 100% | 151.6 MiB/s | 155.2 KiB | 00m00s [51/98] Installing perl-Pod-Usage-4:2.0 100% | 84.3 MiB/s | 86.3 KiB | 00m00s [52/98] Installing perl-Scalar-List-Uti 100% | 149.0 MiB/s | 152.6 KiB | 00m00s [53/98] Installing perl-constant-0:1.33 100% | 0.0 B/s | 27.4 KiB | 00m00s [54/98] Installing perl-File-Basename-0 100% | 0.0 B/s | 14.6 KiB | 00m00s [55/98] Installing perl-Errno-0:1.38-51 100% | 0.0 B/s | 8.8 KiB | 00m00s [56/98] Installing perl-overload-0:1.37 100% | 0.0 B/s | 71.9 KiB | 00m00s [57/98] Installing perl-vars-0:1.05-512 100% | 0.0 B/s | 4.3 KiB | 00m00s [58/98] Installing perl-parent-1:0.244- 100% | 0.0 B/s | 11.0 KiB | 00m00s [59/98] Installing perl-MIME-Base64-0:3 100% | 47.2 MiB/s | 48.4 KiB | 00m00s [60/98] Installing perl-Storable-1:3.32 100% | 228.5 MiB/s | 234.0 KiB | 00m00s [61/98] Installing perl-Getopt-Std-0:1. 100% | 0.0 B/s | 11.7 KiB | 00m00s [62/98] Installing perl-Getopt-Long-1:2 100% | 143.8 MiB/s | 147.2 KiB | 00m00s [63/98] Installing perl-Exporter-0:5.78 100% | 0.0 B/s | 55.6 KiB | 00m00s [64/98] Installing perl-Carp-0:1.54-511 100% | 0.0 B/s | 47.7 KiB | 00m00s [65/98] Installing perl-PathTools-0:3.9 100% | 180.2 MiB/s | 184.6 KiB | 00m00s [66/98] Installing perl-DynaLoader-0:1. 100% | 31.7 MiB/s | 32.5 KiB | 00m00s [67/98] Installing perl-Encode-4:3.21-5 100% | 314.6 MiB/s | 4.7 MiB | 00m00s [68/98] Installing perl-libs-4:5.40.0-5 100% | 262.5 MiB/s | 10.0 MiB | 00m00s [69/98] Installing perl-interpreter-4:5 100% | 121.1 MiB/s | 124.0 KiB | 00m00s [70/98] Installing perl-Term-Table-0:0. 100% | 79.0 MiB/s | 80.9 KiB | 00m00s [71/98] Installing perl-Time-HiRes-4:1. 100% | 119.1 MiB/s | 121.9 KiB | 00m00s [72/98] Installing perl-threads-1:2.40- 100% | 114.4 MiB/s | 117.2 KiB | 00m00s [73/98] Installing perl-Math-Complex-0: 100% | 0.0 B/s | 85.8 KiB | 00m00s [74/98] Installing perl-Math-BigInt-1:2 100% | 313.1 MiB/s | 961.8 KiB | 00m00s [75/98] Installing perl-JSON-PP-1:4.16- 100% | 70.1 MiB/s | 143.6 KiB | 00m00s [76/98] Installing perl-Test-Simple-3:1 100% | 147.9 MiB/s | 1.8 MiB | 00m00s [77/98] Installing hwloc-libs-0:2.11.2- 100% | 477.7 MiB/s | 2.9 MiB | 00m00s [78/98] Installing tbb-bind-0:2022.0.0- 100% | 5.7 MiB/s | 23.3 KiB | 00m00s [79/98] Installing tzdata-0:2024b-1.fc4 100% | 58.9 MiB/s | 1.9 MiB | 00m00s [80/98] Installing python-pip-wheel-0:2 100% | 622.1 MiB/s | 1.2 MiB | 00m00s [81/98] Installing mpdecimal-0:2.5.1-16 100% | 201.2 MiB/s | 206.0 KiB | 00m00s [82/98] Installing libb2-0:0.98.1-12.fc 100% | 0.0 B/s | 43.3 KiB | 00m00s [83/98] Installing expat-0:2.6.4-1.fc42 100% | 46.8 MiB/s | 287.6 KiB | 00m00s [84/98] Installing python3-libs-0:3.13. 100% | 297.9 MiB/s | 40.2 MiB | 00m00s [85/98] Installing libstdc++-devel-0:15 100% | 352.7 MiB/s | 15.9 MiB | 00m00s [86/98] Installing make-1:4.4.1-9.fc42. 100% | 300.0 MiB/s | 1.8 MiB | 00m00s [87/98] Installing gcc-0:15.0.0-0.2.fc4 100% | 371.5 MiB/s | 110.0 MiB | 00m00s [88/98] Installing gcc-c++-0:15.0.0-0.2 100% | 339.6 MiB/s | 40.8 MiB | 00m00s [89/98] Installing gcc-plugin-annobin-0 100% | 4.3 MiB/s | 61.2 KiB | 00m00s [90/98] Installing annobin-plugin-gcc-0 100% | 56.9 MiB/s | 990.9 KiB | 00m00s [91/98] Installing python3-0:3.13.1-2.f 100% | 31.6 MiB/s | 32.4 KiB | 00m00s [92/98] Installing tbb-devel-0:2022.0.0 100% | 199.5 MiB/s | 1.4 MiB | 00m00s [93/98] Installing perl-Test-Deep-0:1.2 100% | 90.9 MiB/s | 279.2 KiB | 00m00s [94/98] Installing perl-Clone-0:0.47-1. 100% | 37.3 MiB/s | 38.2 KiB | 00m00s [95/98] Installing perl-FindBin-0:1.54- 100% | 0.0 B/s | 7.1 KiB | 00m00s [96/98] Installing perl-lib-0:0.65-512. 100% | 0.0 B/s | 8.9 KiB | 00m00s [97/98] Installing zlib-ng-compat-devel 100% | 105.8 MiB/s | 108.3 KiB | 00m00s [98/98] Installing hostname-0:3.25-1.fc 100% | 354.1 KiB/s | 48.5 KiB | 00m00s Warning: skipped OpenPGP checks for 7 packages from repositories: copr_base, https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch Complete! Finish: build setup for bowtie-1.3.1-5.fc42.src.rpm Start: rpmbuild bowtie-1.3.1-5.fc42.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1721174400 Executing(%mkbuilddir): /bin/sh -e /var/tmp/rpm-tmp.vs0pDI + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS + RPM_EC=0 ++ jobs -p + exit 0 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.zOHi3Y + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.q5R98x + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j4 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct ’ at ds.h:373:9, inlined from ‘__ct_base ’ at pat.h:321:3: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘main’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct ’ at ds.h:373:9, inlined from ‘__ct_base ’ at pat.h:321:3: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘main’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3081:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘driver.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3081:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘driver.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.QvSXWB + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + '[' /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT '!=' / ']' + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT ++ dirname /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + mkdir /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin ; \ done + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie + cp -a reads /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + /usr/bin/find-debuginfo -j4 --strict-build-id -m -i --build-id-seed 1.3.1-5.fc42 --unique-debug-suffix -1.3.1-5.fc42.x86_64 --unique-debug-src-base bowtie-1.3.1-5.fc42.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-5.fc42.x86_64 find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j4 + /usr/lib/rpm/redhat/brp-python-hardlink + /usr/bin/add-determinism --brp -j4 /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Scanned 17 directories and 168 files, processed 0 inodes, 0 modified (0 replaced + 0 rewritten), 0 unsupported format, 0 errors Reading /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS/rpm-debuginfo.specpart Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.r8MWUN + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-5.fc42.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.CuOCFe + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/MANUAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/NEWS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/VERSION /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.nlOKg6 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/LICENSE /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-5.fc42 bowtie(x86-64) = 1.3.1-5.fc42 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libc.so.6(GLIBC_2.3.4)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_2.4)(64bit) libc.so.6(GLIBC_2.7)(64bit) libc.so.6(GLIBC_ABI_DT_RELR)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.15)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-5.fc42.x86_64 Provides: bowtie-debugsource = 1.3.1-5.fc42 bowtie-debugsource(x86-64) = 1.3.1-5.fc42 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-5.fc42.x86_64 Provides: bowtie-debuginfo = 1.3.1-5.fc42 bowtie-debuginfo(x86-64) = 1.3.1-5.fc42 debuginfo(build-id) = 10dc74ae7b072744b6aebc11511f6af366291f1f debuginfo(build-id) = 20686245c32b4f963d473ffcca9e37ecc7de72d3 debuginfo(build-id) = 46930475d33371eb3716642432d1baf6c3ef732b debuginfo(build-id) = 5751255042781d710bfd58f746ac6ed6d964f7f5 debuginfo(build-id) = 62557a3f8f943113c4af7306105dd06b6b0a3f8c debuginfo(build-id) = 7629ec0a174025752fe6e348b541d9e23861a940 debuginfo(build-id) = 7bbf3a0ce1bbbc3ea22b193e524d2f593253ac84 debuginfo(build-id) = 856b08de4a45c4d88d21494e1f186377e14607be debuginfo(build-id) = 8b6a1252a19bb6a55c6e6e8173c944c1d7475178 debuginfo(build-id) = 8c95402da4eef7a3e90e7d8f1a179f39a396e174 debuginfo(build-id) = adc6354267c618e57252258f66205d15fc6ac396 debuginfo(build-id) = dc816f688f69789141f4fa9ebb50b59ff2d5026b Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-5.fc42 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-5.fc42.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-1.3.1-5.fc42.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-5.fc42.x86_64.rpm Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.PIwL0R + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-5.fc42.src.rpm Finish: build phase for bowtie-1.3.1-5.fc42.src.rpm INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1734557438.910773/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-5.fc42.src.rpm) Config(child) 3 minutes 16 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "x86_64" }, { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "src" } ] } RPMResults finished