Warning: Permanently added '2620:52:3:1:dead:beef:cafe:c190' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/7070290-fedora-rawhide-x86_64 --chroot fedora-rawhide-x86_64 Version: 0.70 PID: 19343 Logging PID: 19344 Task: {'appstream': False, 'background': False, 'build_id': 7070290, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-x86_64', 'enable_net': False, 'fedora_review': False, 'git_hash': '1b55cb8ca6d77c392997bef8fdf1fbfa4591afdb', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/thrnciar/python-pip-2ebe6bf4/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-4', 'project_dirname': 'python-pip-2ebe6bf4', 'project_name': 'python-pip-2ebe6bf4', 'project_owner': 'thrnciar', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/thrnciar/python-pip-2ebe6bf4/fedora-rawhide-x86_64/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}], 'sandbox': 'thrnciar/python-pip-2ebe6bf4--thrnciar', 'source_json': {}, 'source_type': None, 'submitter': 'thrnciar', 'tags': [], 'task_id': '7070290-fedora-rawhide-x86_64', 'timeout': 18000, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/thrnciar/python-pip-2ebe6bf4/bowtie /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/thrnciar/python-pip-2ebe6bf4/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie'... Running: git checkout 1b55cb8ca6d77c392997bef8fdf1fbfa4591afdb -- cmd: ['git', 'checkout', '1b55cb8ca6d77c392997bef8fdf1fbfa4591afdb', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie rc: 0 stdout: stderr: Note: switching to '1b55cb8ca6d77c392997bef8fdf1fbfa4591afdb'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at 1b55cb8 automatic import of bowtie Running: copr-distgit-client sources cmd: ['copr-distgit-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/thrnciar/python-pip-2ebe6bf4/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 36.3M 0 --:--:-- --:--:-- --:--:-- 36.5M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/thrnciar/python-pip-2ebe6bf4/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 595k 0 --:--:-- --:--:-- --:--:-- 606k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=18000): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1709165765.183624 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 5.5 starting (python version = 3.12.1, NVR = mock-5.5-1.fc39), args: /usr/libexec/mock/mock --spec /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1709165765.183624 -r /var/lib/copr-rpmbuild/results/configs/child.cfg Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie/bowtie.spec) Config(fedora-rawhide-x86_64) Start: clean chroot Finish: clean chroot Mock Version: 5.5 INFO: Mock Version: 5.5 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1709165765.183624/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using bootstrap image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Copy content of container registry.fedoraproject.org/fedora:rawhide to /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1709165765.183624/root INFO: Checking that registry.fedoraproject.org/fedora:rawhide image matches host's architecture INFO: mounting registry.fedoraproject.org/fedora:rawhide with podman image mount INFO: image registry.fedoraproject.org/fedora:rawhide as /var/lib/containers/storage/overlay/48a2c6fc7b98e0c1b5490ae35ea42b03452a2c2274a6c850ea9e24c5a48cfd69/merged INFO: umounting image registry.fedoraproject.org/fedora:rawhide (/var/lib/containers/storage/overlay/48a2c6fc7b98e0c1b5490ae35ea42b03452a2c2274a6c850ea9e24c5a48cfd69/merged) with podman image umount INFO: Using 'dnf' instead of 'dnf5' for bootstrap chroot INFO: Package manager dnf detected and used (fallback) INFO: Bootstrap image not marked ready Start(bootstrap): installing dnf5 tooling No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 8.6 MB/s | 1.1 MB 00:00 fedora 9.5 MB/s | 20 MB 00:02 Last metadata expiration check: 0:00:01 ago on Thu Feb 29 00:16:11 2024. Dependencies resolved. ================================================================================ Package Architecture Version Repository Size ================================================================================ Installing: dnf5 x86_64 5.1.13-1.fc41 fedora 605 k dnf5-plugins x86_64 5.1.13-1.fc41 fedora 352 k Installing dependencies: fmt x86_64 10.2.1-3.fc40 fedora 125 k libdnf5 x86_64 5.1.13-1.fc41 fedora 990 k libdnf5-cli x86_64 5.1.13-1.fc41 fedora 263 k sdbus-cpp x86_64 1.5.0-1.fc41 fedora 113 k Transaction Summary ================================================================================ Install 6 Packages Total download size: 2.4 M Installed size: 6.6 M Downloading Packages: (1/6): fmt-10.2.1-3.fc40.x86_64.rpm 1.1 MB/s | 125 kB 00:00 (2/6): dnf5-plugins-5.1.13-1.fc41.x86_64.rpm 2.2 MB/s | 352 kB 00:00 (3/6): dnf5-5.1.13-1.fc41.x86_64.rpm 3.3 MB/s | 605 kB 00:00 (4/6): libdnf5-cli-5.1.13-1.fc41.x86_64.rpm 6.4 MB/s | 263 kB 00:00 (5/6): sdbus-cpp-1.5.0-1.fc41.x86_64.rpm 5.0 MB/s | 113 kB 00:00 (6/6): libdnf5-5.1.13-1.fc41.x86_64.rpm 6.1 MB/s | 990 kB 00:00 -------------------------------------------------------------------------------- Total 8.0 MB/s | 2.4 MB 00:00 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : fmt-10.2.1-3.fc40.x86_64 1/6 Installing : libdnf5-5.1.13-1.fc41.x86_64 2/6 Installing : libdnf5-cli-5.1.13-1.fc41.x86_64 3/6 Installing : dnf5-5.1.13-1.fc41.x86_64 4/6 Installing : sdbus-cpp-1.5.0-1.fc41.x86_64 5/6 Installing : dnf5-plugins-5.1.13-1.fc41.x86_64 6/6 Running scriptlet: dnf5-plugins-5.1.13-1.fc41.x86_64 6/6 Installed: dnf5-5.1.13-1.fc41.x86_64 dnf5-plugins-5.1.13-1.fc41.x86_64 fmt-10.2.1-3.fc40.x86_64 libdnf5-5.1.13-1.fc41.x86_64 libdnf5-cli-5.1.13-1.fc41.x86_64 sdbus-cpp-1.5.0-1.fc41.x86_64 Complete! INFO: Switching package manager from dnf to the dnf5 (direct choice) Finish(bootstrap): installing dnf5 tooling Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1709165765.183624/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf5 detected and used (direct choice) INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.19.1.1-1.fc40.x86_64 rpm-sequoia-1.6.0-2.fc40.x86_64 python3-dnf-4.19.0-1.fc40.noarch yum-4.19.0-1.fc40.noarch dnf5-5.1.13-1.fc41.x86_64 dnf5-plugins-5.1.13-1.fc41.x86_64 Start: installing minimal buildroot with dnf5 Updating and loading repositories: fedora 100% | 332.7 KiB/s | 17.3 KiB | 00m00s Copr repository 100% | 10.6 KiB/s | 1.5 KiB | 00m00s Copr repository 100% | 8.4 MiB/s | 1.1 MiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing group/module packages: bash x86_64 5.2.26-3.fc40 fedora 8.1 MiB bzip2 x86_64 1.0.8-18.fc40 fedora 91.7 KiB coreutils x86_64 9.4-6.fc40 fedora 5.8 MiB cpio x86_64 2.15-1.fc40 fedora 1.1 MiB diffutils x86_64 3.10-5.fc40 fedora 1.6 MiB fedora-release-common noarch 41-0.5 fedora 19.1 KiB findutils x86_64 1:4.9.0-8.fc40 fedora 1.5 MiB gawk x86_64 5.3.0-3.fc40 fedora 1.7 MiB glibc-minimal-langpack x86_64 2.39.9000-3.fc41 fedora 0.0 B grep x86_64 3.11-7.fc40 fedora 1.0 MiB gzip x86_64 1.13-1.fc40 fedora 385.0 KiB info x86_64 7.1-2.fc40 fedora 357.8 KiB patch x86_64 2.7.6-24.fc40 fedora 262.8 KiB redhat-rpm-config noarch 285-1.fc41 fedora 185.1 KiB rpm-build x86_64 4.19.1.1-1.fc40 fedora 173.7 KiB sed x86_64 4.9-1.fc40 fedora 861.5 KiB shadow-utils x86_64 2:4.15.0rc2-1.fc41 fedora 4.1 MiB tar x86_64 2:1.35-3.fc40 fedora 2.9 MiB unzip x86_64 6.0-63.fc40 fedora 382.8 KiB util-linux x86_64 2.40-0.9.rc1.fc41 fedora 3.7 MiB which x86_64 2.21-41.fc40 fedora 80.2 KiB xz x86_64 5.4.6-1.fc40 fedora 2.0 MiB Installing dependencies: alternatives x86_64 1.26-3.fc40 fedora 62.3 KiB ansible-srpm-macros noarch 1-14.fc40 fedora 35.7 KiB audit-libs x86_64 4.0-8.fc41 copr_base 311.3 KiB authselect x86_64 1.5.0-5.fc41 copr_base 153.6 KiB authselect-libs x86_64 1.5.0-5.fc41 copr_base 818.3 KiB basesystem noarch 11-20.fc40 fedora 0.0 B binutils x86_64 2.42.50-4.fc41 fedora 26.6 MiB binutils-gold x86_64 2.42.50-4.fc41 fedora 2.0 MiB bzip2-libs x86_64 1.0.8-18.fc40 fedora 80.7 KiB ca-certificates noarch 2023.2.62_v7.0.401-6.fc40 fedora 2.3 MiB coreutils-common x86_64 9.4-6.fc40 fedora 11.4 MiB cracklib x86_64 2.9.11-5.fc40 fedora 238.9 KiB crypto-policies noarch 20240201-1.git9f501f3.fc40 fedora 149.3 KiB curl x86_64 8.6.0-7.fc41 fedora 734.6 KiB cyrus-sasl-lib x86_64 2.1.28-19.fc40 fedora 2.3 MiB debugedit x86_64 5.0-14.fc40 fedora 199.0 KiB dwz x86_64 0.15-6.fc40 fedora 290.9 KiB ed x86_64 1.20.1-1.fc41 fedora 146.5 KiB efi-srpm-macros noarch 5-11.fc40 fedora 40.1 KiB elfutils x86_64 0.190-6.fc40 fedora 2.5 MiB elfutils-debuginfod-client x86_64 0.190-6.fc40 fedora 64.9 KiB elfutils-default-yama-scope noarch 0.190-6.fc40 fedora 1.8 KiB elfutils-libelf x86_64 0.190-6.fc40 fedora 1.0 MiB elfutils-libs x86_64 0.190-6.fc40 fedora 642.1 KiB fedora-gpg-keys noarch 41-0.1 fedora 125.0 KiB fedora-release noarch 41-0.5 fedora 0.0 B fedora-release-identity-basic noarch 41-0.5 fedora 694.0 B fedora-repos noarch 41-0.1 fedora 4.9 KiB fedora-repos-rawhide noarch 41-0.1 fedora 2.2 KiB file x86_64 5.45-5.fc41 fedora 103.5 KiB file-libs x86_64 5.45-5.fc41 fedora 9.9 MiB filesystem x86_64 3.18-8.fc40 fedora 106.0 B fonts-srpm-macros noarch 1:2.0.5-14.fc40 fedora 55.3 KiB forge-srpm-macros noarch 0.2.0-3.fc40 fedora 37.4 KiB fpc-srpm-macros noarch 1.3-12.fc40 fedora 144.0 B gdb-minimal x86_64 14.1-8.fc40 fedora 12.3 MiB gdbm x86_64 1:1.23-6.fc40 fedora 460.9 KiB gdbm-libs x86_64 1:1.23-6.fc40 fedora 121.9 KiB ghc-srpm-macros noarch 1.6.1-5.fc40 fedora 369.0 B glibc x86_64 2.39.9000-3.fc41 fedora 6.7 MiB glibc-common x86_64 2.39.9000-3.fc41 fedora 1.0 MiB glibc-gconv-extra x86_64 2.39.9000-3.fc41 fedora 7.8 MiB gmp x86_64 1:6.3.0-1.fc41 fedora 803.4 KiB gnat-srpm-macros noarch 6-5.fc40 fedora 1.0 KiB go-srpm-macros noarch 3.4.0-2.fc40 fedora 60.6 KiB jansson x86_64 2.13.1-9.fc40 fedora 88.3 KiB kernel-srpm-macros noarch 1.0-22.fc40 fedora 1.9 KiB keyutils-libs x86_64 1.6.3-3.fc40 fedora 54.4 KiB krb5-libs x86_64 1.21.2-5.fc40 fedora 2.3 MiB libacl x86_64 2.3.2-1.fc40 fedora 40.0 KiB libarchive x86_64 3.7.2-3.fc40 fedora 914.6 KiB libattr x86_64 2.5.2-3.fc40 fedora 28.5 KiB libblkid x86_64 2.40-0.9.rc1.fc41 fedora 237.0 KiB libbrotli x86_64 1.1.0-3.fc40 fedora 829.5 KiB libcap x86_64 2.69-3.fc40 fedora 217.2 KiB libcap-ng x86_64 0.8.4-4.fc40 fedora 73.1 KiB libcom_err x86_64 1.47.0-5.fc40 fedora 67.2 KiB libcurl x86_64 8.6.0-7.fc41 fedora 772.8 KiB libeconf x86_64 0.5.2-3.fc40 fedora 52.0 KiB libevent x86_64 2.1.12-12.fc40 fedora 895.6 KiB libfdisk x86_64 2.40-0.9.rc1.fc41 fedora 363.3 KiB libffi x86_64 3.4.4-7.fc40 fedora 81.6 KiB libgcc x86_64 14.0.1-0.7.fc41 fedora 270.6 KiB libgomp x86_64 14.0.1-0.7.fc41 fedora 518.0 KiB libidn2 x86_64 2.3.7-1.fc40 fedora 329.1 KiB libmount x86_64 2.40-0.9.rc1.fc41 fedora 352.1 KiB libnghttp2 x86_64 1.59.0-2.fc40 fedora 166.1 KiB libnsl2 x86_64 2.0.1-1.fc40 fedora 57.9 KiB libpkgconf x86_64 2.1.0-1.fc40 fedora 74.2 KiB libpsl x86_64 0.21.5-3.fc40 fedora 80.5 KiB libpwquality x86_64 1.4.5-9.fc40 fedora 417.8 KiB libselinux x86_64 3.6-4.fc40 fedora 173.0 KiB libsemanage x86_64 3.6-3.fc40 fedora 293.5 KiB libsepol x86_64 3.6-3.fc40 fedora 802.0 KiB libsmartcols x86_64 2.40-0.9.rc1.fc41 fedora 180.7 KiB libssh x86_64 0.10.6-4.fc40 fedora 509.3 KiB libssh-config noarch 0.10.6-4.fc40 fedora 277.0 B libstdc++ x86_64 14.0.1-0.7.fc41 fedora 2.8 MiB libtasn1 x86_64 4.19.0-6.fc40 fedora 175.7 KiB libtirpc x86_64 1.3.4-1.rc2.fc40.2 fedora 202.8 KiB libtool-ltdl x86_64 2.4.7-10.fc40 fedora 66.2 KiB libunistring x86_64 1.1-7.fc41 fedora 1.7 MiB libutempter x86_64 1.2.1-13.fc40 fedora 57.7 KiB libuuid x86_64 2.40-0.9.rc1.fc41 fedora 37.6 KiB libverto x86_64 0.3.2-8.fc40 fedora 29.5 KiB libxcrypt x86_64 4.4.36-5.fc40 fedora 262.8 KiB libxml2 x86_64 2.12.5-1.fc40 fedora 1.7 MiB libzstd x86_64 1.5.5-5.fc40 fedora 772.0 KiB lua-libs x86_64 5.4.6-5.fc40 fedora 281.1 KiB lua-srpm-macros noarch 1-13.fc40 fedora 1.3 KiB lz4-libs x86_64 1.9.4-6.fc40 fedora 129.4 KiB mpfr x86_64 4.2.1-3.fc40 fedora 832.0 KiB ncurses-base noarch 6.4-12.20240127.fc40 fedora 326.2 KiB ncurses-libs x86_64 6.4-12.20240127.fc40 fedora 963.2 KiB ocaml-srpm-macros noarch 9-3.fc40 fedora 1.9 KiB openblas-srpm-macros noarch 2-16.fc40 fedora 104.0 B openldap x86_64 2.6.7-1.fc40 fedora 635.1 KiB openssl-libs x86_64 1:3.2.1-2.fc40 fedora 7.8 MiB p11-kit x86_64 0.25.3-4.fc40 fedora 2.2 MiB p11-kit-trust x86_64 0.25.3-4.fc40 fedora 391.4 KiB package-notes-srpm-macros noarch 0.5-11.fc40 fedora 1.6 KiB pam x86_64 1.6.0-2.fc41 fedora 1.8 MiB pam-libs x86_64 1.6.0-2.fc41 fedora 135.0 KiB pcre2 x86_64 10.42-2.fc40.2 fedora 637.6 KiB pcre2-syntax noarch 10.42-2.fc40.2 fedora 235.1 KiB perl-srpm-macros noarch 1-53.fc40 fedora 861.0 B pkgconf x86_64 2.1.0-1.fc40 fedora 82.4 KiB pkgconf-m4 noarch 2.1.0-1.fc40 fedora 13.9 KiB pkgconf-pkg-config x86_64 2.1.0-1.fc40 fedora 989.0 B popt x86_64 1.19-6.fc40 fedora 136.9 KiB publicsuffix-list-dafsa noarch 20240107-3.fc40 fedora 67.5 KiB pyproject-srpm-macros noarch 1.12.0-1.fc40 fedora 1.5 KiB python-srpm-macros noarch 3.12-7.fc40 fedora 50.1 KiB qt5-srpm-macros noarch 5.15.12-3.fc40 fedora 492.0 B qt6-srpm-macros noarch 6.6.2-1.fc41 fedora 456.0 B readline x86_64 8.2-8.fc40 fedora 489.2 KiB rpm x86_64 4.19.1.1-1.fc40 fedora 3.0 MiB rpm-build-libs x86_64 4.19.1.1-1.fc40 fedora 198.4 KiB rpm-libs x86_64 4.19.1.1-1.fc40 fedora 709.9 KiB rpm-sequoia x86_64 1.6.0-2.fc40 fedora 2.2 MiB rust-srpm-macros noarch 26.1-1.fc41 fedora 4.8 KiB setup noarch 2.14.5-2.fc40 fedora 720.4 KiB sqlite-libs x86_64 3.45.1-2.fc40 fedora 1.4 MiB systemd-libs x86_64 255.3-1.fc40 fedora 1.9 MiB util-linux-core x86_64 2.40-0.9.rc1.fc41 fedora 1.4 MiB xxhash-libs x86_64 0.8.2-2.fc40 fedora 88.5 KiB xz-libs x86_64 5.4.6-1.fc40 fedora 209.8 KiB zig-srpm-macros noarch 1-2.fc40 fedora 1.1 KiB zip x86_64 3.0-40.fc40 fedora 703.2 KiB zlib-ng-compat x86_64 2.1.6-2.fc40 fedora 134.0 KiB zstd x86_64 1.5.5-5.fc40 fedora 1.6 MiB Installing groups: Buildsystem building group Transaction Summary: Installing: 153 packages Total size of inbound packages is 53 MiB. Need to download 0 B. After this operation 178 MiB will be used (install 178 MiB, remove 0 B). [ 1/153] tar-2:1.35-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 2/153] bzip2-0:1.0.8-18.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 3/153] redhat-rpm-config-0:285-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 4/153] rpm-build-0:4.19.1.1-1.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/153] unzip-0:6.0-63.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/153] cpio-0:2.15-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/153] which-0:2.21-41.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/153] bash-0:5.2.26-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/153] coreutils-0:9.4-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 10/153] grep-0:3.11-7.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 11/153] patch-0:2.7.6-24.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 12/153] sed-0:4.9-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 13/153] shadow-utils-2:4.15.0rc2-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 14/153] diffutils-0:3.10-5.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 15/153] fedora-release-common-0:41-0. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 16/153] findutils-1:4.9.0-8.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 17/153] glibc-minimal-langpack-0:2.39 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 18/153] gzip-0:1.13-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 19/153] info-0:7.1-2.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 20/153] xz-0:5.4.6-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 21/153] util-linux-0:2.40-0.9.rc1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 22/153] gawk-0:5.3.0-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 23/153] glibc-0:2.39.9000-3.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 24/153] libacl-0:2.3.2-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 25/153] libselinux-0:3.6-4.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 26/153] bzip2-libs-0:1.0.8-18.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 27/153] ansible-srpm-macros-0:1-14.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 28/153] dwz-0:0.15-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 29/153] efi-srpm-macros-0:5-11.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 30/153] file-0:5.45-5.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 31/153] fonts-srpm-macros-1:2.0.5-14. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 32/153] forge-srpm-macros-0:0.2.0-3.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 33/153] fpc-srpm-macros-0:1.3-12.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 34/153] ghc-srpm-macros-0:1.6.1-5.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 35/153] gnat-srpm-macros-0:6-5.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 36/153] go-srpm-macros-0:3.4.0-2.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 37/153] kernel-srpm-macros-0:1.0-22.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 38/153] lua-srpm-macros-0:1-13.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 39/153] ocaml-srpm-macros-0:9-3.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 40/153] openblas-srpm-macros-0:2-16.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 41/153] package-notes-srpm-macros-0:0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 42/153] perl-srpm-macros-0:1-53.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 43/153] pyproject-srpm-macros-0:1.12. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 44/153] python-srpm-macros-0:3.12-7.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 45/153] qt5-srpm-macros-0:5.15.12-3.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 46/153] qt6-srpm-macros-0:6.6.2-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 47/153] rpm-0:4.19.1.1-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 48/153] rust-srpm-macros-0:26.1-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 49/153] zig-srpm-macros-0:1-2.fc40.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 50/153] zip-0:3.0-40.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 51/153] debugedit-0:5.0-14.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 52/153] elfutils-0:0.190-6.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 53/153] elfutils-libelf-0:0.190-6.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 54/153] popt-0:1.19-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 55/153] readline-0:8.2-8.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 56/153] rpm-build-libs-0:4.19.1.1-1.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 57/153] rpm-libs-0:4.19.1.1-1.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 58/153] zstd-0:1.5.5-5.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 59/153] filesystem-0:3.18-8.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 60/153] ncurses-libs-0:6.4-12.2024012 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 61/153] coreutils-common-0:9.4-6.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 62/153] gmp-1:6.3.0-1.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 63/153] libattr-0:2.5.2-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 64/153] libcap-0:2.69-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 65/153] openssl-libs-1:3.2.1-2.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 66/153] pcre2-0:10.42-2.fc40.2.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 67/153] ed-0:1.20.1-1.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 68/153] libeconf-0:0.5.2-3.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 69/153] libsemanage-0:3.6-3.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 70/153] libxcrypt-0:4.4.36-5.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 71/153] pam-libs-0:1.6.0-2.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 72/153] setup-0:2.14.5-2.fc40.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 73/153] fedora-repos-0:41-0.1.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 74/153] glibc-common-0:2.39.9000-3.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 75/153] xz-libs-0:5.4.6-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 76/153] libblkid-0:2.40-0.9.rc1.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 77/153] libcap-ng-0:0.8.4-4.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 78/153] libfdisk-0:2.40-0.9.rc1.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 79/153] libmount-0:2.40-0.9.rc1.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 80/153] libsmartcols-0:2.40-0.9.rc1.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 81/153] libutempter-0:1.2.1-13.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 82/153] libuuid-0:2.40-0.9.rc1.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 83/153] systemd-libs-0:255.3-1.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 84/153] util-linux-core-0:2.40-0.9.rc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 85/153] zlib-ng-compat-0:2.1.6-2.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 86/153] mpfr-0:4.2.1-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 87/153] glibc-gconv-extra-0:2.39.9000 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 88/153] basesystem-0:11-20.fc40.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 89/153] libgcc-0:14.0.1-0.7.fc41.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 90/153] libsepol-0:3.6-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 91/153] file-libs-0:5.45-5.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 92/153] curl-0:8.6.0-7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 93/153] libarchive-0:3.7.2-3.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 94/153] elfutils-libs-0:0.190-6.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 95/153] libstdc++-0:14.0.1-0.7.fc41.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 96/153] libzstd-0:1.5.5-5.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 97/153] libgomp-0:14.0.1-0.7.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 98/153] lua-libs-0:5.4.6-5.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 99/153] rpm-sequoia-0:1.6.0-2.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [100/153] sqlite-libs-0:3.45.1-2.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [101/153] lz4-libs-0:1.9.4-6.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [102/153] ncurses-base-0:6.4-12.2024012 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [103/153] ca-certificates-0:2023.2.62_v 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [104/153] crypto-policies-0:20240201-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [105/153] pcre2-syntax-0:10.42-2.fc40.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [106/153] fedora-gpg-keys-0:41-0.1.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [107/153] fedora-repos-rawhide-0:41-0.1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [108/153] libxml2-0:2.12.5-1.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [109/153] elfutils-default-yama-scope-0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [110/153] audit-libs-0:4.0-8.fc41.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [111/153] pam-0:1.6.0-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [112/153] gdbm-libs-1:1.23-6.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [113/153] libnsl2-0:2.0.1-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [114/153] libpwquality-0:1.4.5-9.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [115/153] libtirpc-0:1.3.4-1.rc2.fc40.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [116/153] cracklib-0:2.9.11-5.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [117/153] krb5-libs-0:1.21.2-5.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [118/153] libcom_err-0:1.47.0-5.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [119/153] keyutils-libs-0:1.6.3-3.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [120/153] libverto-0:0.3.2-8.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [121/153] authselect-libs-0:1.5.0-5.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [122/153] authselect-0:1.5.0-5.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [123/153] binutils-0:2.42.50-4.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [124/153] alternatives-0:1.26-3.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [125/153] binutils-gold-0:2.42.50-4.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [126/153] elfutils-debuginfod-client-0: 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [127/153] jansson-0:2.13.1-9.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [128/153] pkgconf-pkg-config-0:2.1.0-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [129/153] pkgconf-0:2.1.0-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [130/153] pkgconf-m4-0:2.1.0-1.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [131/153] libpkgconf-0:2.1.0-1.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [132/153] gdbm-1:1.23-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [133/153] p11-kit-0:0.25.3-4.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [134/153] libffi-0:3.4.4-7.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [135/153] libtasn1-0:4.19.0-6.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [136/153] p11-kit-trust-0:0.25.3-4.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [137/153] fedora-release-0:41-0.5.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [138/153] gdb-minimal-0:14.1-8.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [139/153] xxhash-libs-0:0.8.2-2.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [140/153] fedora-release-identity-basic 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [141/153] libcurl-0:8.6.0-7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [142/153] libbrotli-0:1.1.0-3.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [143/153] libidn2-0:2.3.7-1.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [144/153] libnghttp2-0:1.59.0-2.fc40.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [145/153] libpsl-0:0.21.5-3.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [146/153] libssh-0:0.10.6-4.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [147/153] openldap-0:2.6.7-1.fc40.x86_6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [148/153] libunistring-0:1.1-7.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [149/153] publicsuffix-list-dafsa-0:202 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [150/153] libssh-config-0:0.10.6-4.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [151/153] cyrus-sasl-lib-0:2.1.28-19.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [152/153] libevent-0:2.1.12-12.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [153/153] libtool-ltdl-0:2.4.7-10.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [153/153] Total 100% | 0.0 B/s | 0.0 B | 00m00s Running transaction Importing PGP key 0xE99D6AD1: Userid : "Fedora (41) " Fingerprint: 466CF2D8B60BC3057AA9453ED0622462E99D6AD1 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-41-primary The key was successfully imported. Importing PGP key 0xE99D6AD1: Userid : "Fedora (41) " Fingerprint: 466CF2D8B60BC3057AA9453ED0622462E99D6AD1 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-41-primary The key was successfully imported. Importing PGP key 0xA15B79CC: Userid : "Fedora (40) " Fingerprint: 115DF9AEF857853EE8445D0A0727707EA15B79CC From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-40-primary The key was successfully imported. [ 1/155] Verify package files 100% | 558.0 B/s | 153.0 B | 00m00s >>> Running pre-transaction scriptlet: filesystem-0:3.18-8.fc40.x86_64 >>> Stop pre-transaction scriptlet: filesystem-0:3.18-8.fc40.x86_64 [ 2/155] Prepare transaction 100% | 1.8 KiB/s | 153.0 B | 00m00s [ 3/155] Installing libgcc-0:14.0.1-0. 100% | 88.6 MiB/s | 272.3 KiB | 00m00s >>> Running post-install scriptlet: libgcc-0:14.0.1-0.7.fc41.x86_64 >>> Stop post-install scriptlet: libgcc-0:14.0.1-0.7.fc41.x86_64 [ 4/155] Installing crypto-policies-0: 100% | 16.1 MiB/s | 181.7 KiB | 00m00s >>> Running post-install scriptlet: crypto-policies-0:20240201-1.git9f501f3.fc40 >>> Stop post-install scriptlet: crypto-policies-0:20240201-1.git9f501f3.fc40.no [ 5/155] Installing fedora-release-ide 100% | 929.7 KiB/s | 952.0 B | 00m00s [ 6/155] Installing fedora-gpg-keys-0: 100% | 20.8 MiB/s | 170.1 KiB | 00m00s [ 7/155] Installing fedora-repos-rawhi 100% | 0.0 B/s | 2.4 KiB | 00m00s [ 8/155] Installing fedora-repos-0:41- 100% | 5.6 MiB/s | 5.7 KiB | 00m00s [ 9/155] Installing fedora-release-com 100% | 11.3 MiB/s | 23.2 KiB | 00m00s [ 10/155] Installing fedora-release-0:4 100% | 0.0 B/s | 124.0 B | 00m00s [ 11/155] Installing setup-0:2.14.5-2.f 100% | 47.3 MiB/s | 725.8 KiB | 00m00s >>> Running post-install scriptlet: setup-0:2.14.5-2.fc40.noarch >>> Stop post-install scriptlet: setup-0:2.14.5-2.fc40.noarch [ 12/155] Installing filesystem-0:3.18- 100% | 1.7 MiB/s | 212.4 KiB | 00m00s [ 13/155] Installing basesystem-0:11-20 100% | 0.0 B/s | 124.0 B | 00m00s [ 14/155] Installing libssh-config-0:0. 100% | 0.0 B/s | 816.0 B | 00m00s [ 15/155] Installing publicsuffix-list- 100% | 66.7 MiB/s | 68.3 KiB | 00m00s [ 16/155] Installing pkgconf-m4-0:2.1.0 100% | 14.0 MiB/s | 14.3 KiB | 00m00s [ 17/155] Installing pcre2-syntax-0:10. 100% | 116.0 MiB/s | 237.6 KiB | 00m00s [ 18/155] Installing ncurses-base-0:6.4 100% | 38.2 MiB/s | 351.6 KiB | 00m00s [ 19/155] Installing glibc-minimal-lang 100% | 0.0 B/s | 124.0 B | 00m00s [ 20/155] Installing ncurses-libs-0:6.4 100% | 135.3 MiB/s | 969.7 KiB | 00m00s >>> Running pre-install scriptlet: glibc-0:2.39.9000-3.fc41.x86_64 >>> Stop pre-install scriptlet: glibc-0:2.39.9000-3.fc41.x86_64 [ 21/155] Installing glibc-0:2.39.9000- 100% | 124.9 MiB/s | 6.7 MiB | 00m00s >>> Running post-install scriptlet: glibc-0:2.39.9000-3.fc41.x86_64 >>> Stop post-install scriptlet: glibc-0:2.39.9000-3.fc41.x86_64 [ 22/155] Installing bash-0:5.2.26-3.fc 100% | 255.0 MiB/s | 8.2 MiB | 00m00s >>> Running post-install scriptlet: bash-0:5.2.26-3.fc40.x86_64 >>> Stop post-install scriptlet: bash-0:5.2.26-3.fc40.x86_64 [ 23/155] Installing glibc-common-0:2.3 100% | 127.6 MiB/s | 1.0 MiB | 00m00s [ 24/155] Installing glibc-gconv-extra- 100% | 133.3 MiB/s | 7.9 MiB | 00m00s >>> Running post-install scriptlet: glibc-gconv-extra-0:2.39.9000-3.fc41.x86_64 >>> Stop post-install scriptlet: glibc-gconv-extra-0:2.39.9000-3.fc41.x86_64 [ 25/155] Installing zlib-ng-compat-0:2 100% | 131.7 MiB/s | 134.8 KiB | 00m00s [ 26/155] Installing xz-libs-0:5.4.6-1. 100% | 206.0 MiB/s | 210.9 KiB | 00m00s [ 27/155] Installing bzip2-libs-0:1.0.8 100% | 79.9 MiB/s | 81.8 KiB | 00m00s [ 28/155] Installing popt-0:1.19-6.fc40 100% | 35.0 MiB/s | 143.5 KiB | 00m00s [ 29/155] Installing readline-0:8.2-8.f 100% | 160.0 MiB/s | 491.4 KiB | 00m00s [ 30/155] Installing libuuid-0:2.40-0.9 100% | 38.0 MiB/s | 38.9 KiB | 00m00s [ 31/155] Installing libstdc++-0:14.0.1 100% | 251.1 MiB/s | 2.8 MiB | 00m00s [ 32/155] Installing libzstd-0:1.5.5-5. 100% | 251.7 MiB/s | 773.2 KiB | 00m00s [ 33/155] Installing elfutils-libelf-0: 100% | 246.4 MiB/s | 1.0 MiB | 00m00s [ 34/155] Installing libblkid-0:2.40-0. 100% | 116.2 MiB/s | 238.1 KiB | 00m00s [ 35/155] Installing gmp-1:6.3.0-1.fc41 100% | 262.2 MiB/s | 805.6 KiB | 00m00s [ 36/155] Installing libattr-0:2.5.2-3. 100% | 28.8 MiB/s | 29.5 KiB | 00m00s [ 37/155] Installing libacl-0:2.3.2-1.f 100% | 39.9 MiB/s | 40.8 KiB | 00m00s [ 38/155] Installing libxcrypt-0:4.4.36 100% | 129.7 MiB/s | 265.5 KiB | 00m00s [ 39/155] Installing libeconf-0:0.5.2-3 100% | 52.4 MiB/s | 53.7 KiB | 00m00s [ 40/155] Installing lz4-libs-0:1.9.4-6 100% | 127.4 MiB/s | 130.5 KiB | 00m00s [ 41/155] Installing gdbm-libs-1:1.23-6 100% | 120.7 MiB/s | 123.6 KiB | 00m00s [ 42/155] Installing mpfr-0:4.2.1-3.fc4 100% | 203.5 MiB/s | 833.5 KiB | 00m00s [ 43/155] Installing gawk-0:5.3.0-3.fc4 100% | 172.8 MiB/s | 1.7 MiB | 00m00s [ 44/155] Installing dwz-0:0.15-6.fc40. 100% | 142.7 MiB/s | 292.3 KiB | 00m00s [ 45/155] Installing unzip-0:6.0-63.fc4 100% | 125.8 MiB/s | 386.3 KiB | 00m00s [ 46/155] Installing file-libs-0:5.45-5 100% | 451.4 MiB/s | 9.9 MiB | 00m00s [ 47/155] Installing file-0:5.45-5.fc41 100% | 102.6 MiB/s | 105.0 KiB | 00m00s [ 48/155] Installing pcre2-0:10.42-2.fc 100% | 208.0 MiB/s | 639.1 KiB | 00m00s [ 49/155] Installing grep-0:3.11-7.fc40 100% | 111.5 MiB/s | 1.0 MiB | 00m00s [ 50/155] Installing xz-0:5.4.6-1.fc40. 100% | 143.0 MiB/s | 2.0 MiB | 00m00s [ 51/155] Installing libcap-ng-0:0.8.4- 100% | 73.2 MiB/s | 75.0 KiB | 00m00s [ 52/155] Installing audit-libs-0:4.0-8 100% | 153.0 MiB/s | 313.4 KiB | 00m00s [ 53/155] Installing pam-libs-0:1.6.0-2 100% | 67.0 MiB/s | 137.3 KiB | 00m00s [ 54/155] Installing libcap-0:2.69-3.fc 100% | 72.2 MiB/s | 221.9 KiB | 00m00s [ 55/155] Installing systemd-libs-0:255 100% | 241.3 MiB/s | 1.9 MiB | 00m00s [ 56/155] Installing libsmartcols-0:2.4 100% | 177.6 MiB/s | 181.9 KiB | 00m00s [ 57/155] Installing libsepol-0:3.6-3.f 100% | 261.4 MiB/s | 803.0 KiB | 00m00s [ 58/155] Installing libselinux-0:3.6-4 100% | 85.1 MiB/s | 174.3 KiB | 00m00s [ 59/155] Installing sed-0:4.9-1.fc40.x 100% | 121.3 MiB/s | 869.7 KiB | 00m00s [ 60/155] Installing findutils-1:4.9.0- 100% | 162.9 MiB/s | 1.5 MiB | 00m00s [ 61/155] Installing libmount-0:2.40-0. 100% | 172.5 MiB/s | 353.3 KiB | 00m00s [ 62/155] Installing lua-libs-0:5.4.6-5 100% | 137.8 MiB/s | 282.3 KiB | 00m00s [ 63/155] Installing libcom_err-0:1.47. 100% | 66.7 MiB/s | 68.3 KiB | 00m00s [ 64/155] Installing alternatives-0:1.2 100% | 62.5 MiB/s | 64.0 KiB | 00m00s [ 65/155] Installing jansson-0:2.13.1-9 100% | 87.6 MiB/s | 89.7 KiB | 00m00s [ 66/155] Installing libtasn1-0:4.19.0- 100% | 173.3 MiB/s | 177.5 KiB | 00m00s [ 67/155] Installing libunistring-0:1.1 100% | 288.5 MiB/s | 1.7 MiB | 00m00s [ 68/155] Installing libidn2-0:2.3.7-1. 100% | 81.8 MiB/s | 335.0 KiB | 00m00s [ 69/155] Installing libpsl-0:0.21.5-3. 100% | 39.9 MiB/s | 81.6 KiB | 00m00s [ 70/155] Installing util-linux-core-0: 100% | 138.5 MiB/s | 1.4 MiB | 00m00s [ 71/155] Installing tar-2:1.35-3.fc40. 100% | 227.0 MiB/s | 3.0 MiB | 00m00s [ 72/155] Installing libsemanage-0:3.6- 100% | 96.1 MiB/s | 295.3 KiB | 00m00s [ 73/155] Installing shadow-utils-2:4.1 100% | 77.3 MiB/s | 4.2 MiB | 00m00s >>> Running pre-install scriptlet: libutempter-0:1.2.1-13.fc40.x86_64 >>> Stop pre-install scriptlet: libutempter-0:1.2.1-13.fc40.x86_64 [ 74/155] Installing libutempter-0:1.2. 100% | 29.2 MiB/s | 59.7 KiB | 00m00s [ 75/155] Installing zip-0:3.0-40.fc40. 100% | 138.1 MiB/s | 707.1 KiB | 00m00s [ 76/155] Installing gdbm-1:1.23-6.fc40 100% | 113.7 MiB/s | 465.8 KiB | 00m00s [ 77/155] Installing cyrus-sasl-lib-0:2 100% | 228.3 MiB/s | 2.3 MiB | 00m00s [ 78/155] Installing zstd-0:1.5.5-5.fc4 100% | 274.4 MiB/s | 1.6 MiB | 00m00s [ 79/155] Installing libfdisk-0:2.40-0. 100% | 178.0 MiB/s | 364.6 KiB | 00m00s [ 80/155] Installing bzip2-0:1.0.8-18.f 100% | 47.0 MiB/s | 96.2 KiB | 00m00s [ 81/155] Installing libxml2-0:2.12.5-1 100% | 242.8 MiB/s | 1.7 MiB | 00m00s [ 82/155] Installing sqlite-libs-0:3.45 100% | 233.6 MiB/s | 1.4 MiB | 00m00s [ 83/155] Installing ed-0:1.20.1-1.fc41 100% | 72.6 MiB/s | 148.8 KiB | 00m00s [ 84/155] Installing patch-0:2.7.6-24.f 100% | 129.0 MiB/s | 264.3 KiB | 00m00s [ 85/155] Installing elfutils-default-y 100% | 227.0 KiB/s | 2.0 KiB | 00m00s >>> Running post-install scriptlet: elfutils-default-yama-scope-0:0.190-6.fc40.n >>> Stop post-install scriptlet: elfutils-default-yama-scope-0:0.190-6.fc40.noar [ 86/155] Installing cpio-0:2.15-1.fc40 100% | 137.5 MiB/s | 1.1 MiB | 00m00s [ 87/155] Installing diffutils-0:3.10-5 100% | 176.2 MiB/s | 1.6 MiB | 00m00s [ 88/155] Installing libgomp-0:14.0.1-0 100% | 253.6 MiB/s | 519.4 KiB | 00m00s [ 89/155] Installing keyutils-libs-0:1. 100% | 54.5 MiB/s | 55.8 KiB | 00m00s [ 90/155] Installing libverto-0:0.3.2-8 100% | 30.5 MiB/s | 31.3 KiB | 00m00s [ 91/155] Installing libpkgconf-0:2.1.0 100% | 73.6 MiB/s | 75.3 KiB | 00m00s [ 92/155] Installing pkgconf-0:2.1.0-1. 100% | 41.5 MiB/s | 84.9 KiB | 00m00s [ 93/155] Installing pkgconf-pkg-config 100% | 1.7 MiB/s | 1.8 KiB | 00m00s [ 94/155] Installing libffi-0:3.4.4-7.f 100% | 81.0 MiB/s | 83.0 KiB | 00m00s [ 95/155] Installing p11-kit-0:0.25.3-4 100% | 146.3 MiB/s | 2.2 MiB | 00m00s [ 96/155] Installing p11-kit-trust-0:0. 100% | 27.4 MiB/s | 393.1 KiB | 00m00s >>> Running post-install scriptlet: p11-kit-trust-0:0.25.3-4.fc40.x86_64 >>> Stop post-install scriptlet: p11-kit-trust-0:0.25.3-4.fc40.x86_64 [ 97/155] Installing xxhash-libs-0:0.8. 100% | 87.8 MiB/s | 89.9 KiB | 00m00s [ 98/155] Installing libbrotli-0:1.1.0- 100% | 203.1 MiB/s | 831.8 KiB | 00m00s [ 99/155] Installing libnghttp2-0:1.59. 100% | 163.3 MiB/s | 167.2 KiB | 00m00s [100/155] Installing libtool-ltdl-0:2.4 100% | 65.7 MiB/s | 67.3 KiB | 00m00s [101/155] Installing coreutils-common-0 100% | 249.2 MiB/s | 11.5 MiB | 00m00s [102/155] Installing openssl-libs-1:3.2 100% | 311.5 MiB/s | 7.8 MiB | 00m00s [103/155] Installing coreutils-0:9.4-6. 100% | 153.0 MiB/s | 5.8 MiB | 00m00s >>> Running pre-install scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.fc40.n >>> Stop pre-install scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.fc40.noar [104/155] Installing ca-certificates-0: 100% | 2.4 MiB/s | 2.3 MiB | 00m01s >>> Running post-install scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.fc40. >>> Stop post-install scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.fc40.noa [105/155] Installing krb5-libs-0:1.21.2 100% | 176.5 MiB/s | 2.3 MiB | 00m00s [106/155] Installing libtirpc-0:1.3.4-1 100% | 99.9 MiB/s | 204.6 KiB | 00m00s [107/155] Installing gzip-0:1.13-1.fc40 100% | 95.4 MiB/s | 390.6 KiB | 00m00s [108/155] Installing authselect-libs-0: 100% | 90.4 MiB/s | 833.2 KiB | 00m00s [109/155] Installing authselect-0:1.5.0 100% | 51.4 MiB/s | 157.9 KiB | 00m00s [110/155] Installing cracklib-0:2.9.11- 100% | 34.9 MiB/s | 250.3 KiB | 00m00s [111/155] Installing libpwquality-0:1.4 100% | 52.5 MiB/s | 430.1 KiB | 00m00s [112/155] Installing libnsl2-0:2.0.1-1. 100% | 28.8 MiB/s | 59.0 KiB | 00m00s [113/155] Installing pam-0:1.6.0-2.fc41 100% | 75.5 MiB/s | 1.8 MiB | 00m00s [114/155] Installing libssh-0:0.10.6-4. 100% | 166.5 MiB/s | 511.4 KiB | 00m00s [115/155] Installing libarchive-0:3.7.2 100% | 179.0 MiB/s | 916.6 KiB | 00m00s [116/155] Installing rpm-sequoia-0:1.6. 100% | 278.7 MiB/s | 2.2 MiB | 00m00s [117/155] Installing rpm-libs-0:4.19.1. 100% | 173.7 MiB/s | 711.4 KiB | 00m00s [118/155] Installing libevent-0:2.1.12- 100% | 219.6 MiB/s | 899.4 KiB | 00m00s [119/155] Installing openldap-0:2.6.7-1 100% | 156.0 MiB/s | 638.9 KiB | 00m00s [120/155] Installing libcurl-0:8.6.0-7. 100% | 188.9 MiB/s | 773.9 KiB | 00m00s [121/155] Installing elfutils-libs-0:0. 100% | 157.2 MiB/s | 644.0 KiB | 00m00s [122/155] Installing elfutils-debuginfo 100% | 32.7 MiB/s | 66.9 KiB | 00m00s [123/155] Installing binutils-gold-0:2. 100% | 101.5 MiB/s | 2.0 MiB | 00m00s >>> Running post-install scriptlet: binutils-gold-0:2.42.50-4.fc41.x86_64 >>> Stop post-install scriptlet: binutils-gold-0:2.42.50-4.fc41.x86_64 [124/155] Installing binutils-0:2.42.50 100% | 261.4 MiB/s | 26.7 MiB | 00m00s >>> Running post-install scriptlet: binutils-0:2.42.50-4.fc41.x86_64 >>> Stop post-install scriptlet: binutils-0:2.42.50-4.fc41.x86_64 [125/155] Installing elfutils-0:0.190-6 100% | 229.9 MiB/s | 2.5 MiB | 00m00s [126/155] Installing gdb-minimal-0:14.1 100% | 299.3 MiB/s | 12.3 MiB | 00m00s [127/155] Installing debugedit-0:5.0-14 100% | 98.5 MiB/s | 201.7 KiB | 00m00s [128/155] Installing rpm-build-libs-0:4 100% | 97.3 MiB/s | 199.2 KiB | 00m00s [129/155] Installing curl-0:8.6.0-7.fc4 100% | 36.0 MiB/s | 736.9 KiB | 00m00s >>> Running pre-install scriptlet: rpm-0:4.19.1.1-1.fc40.x86_64 >>> Stop pre-install scriptlet: rpm-0:4.19.1.1-1.fc40.x86_64 [130/155] Installing rpm-0:4.19.1.1-1.f 100% | 85.6 MiB/s | 2.4 MiB | 00m00s [131/155] Installing efi-srpm-macros-0: 100% | 40.2 MiB/s | 41.2 KiB | 00m00s [132/155] Installing lua-srpm-macros-0: 100% | 1.9 MiB/s | 1.9 KiB | 00m00s [133/155] Installing zig-srpm-macros-0: 100% | 1.6 MiB/s | 1.7 KiB | 00m00s [134/155] Installing rust-srpm-macros-0 100% | 5.4 MiB/s | 5.5 KiB | 00m00s [135/155] Installing qt6-srpm-macros-0: 100% | 0.0 B/s | 732.0 B | 00m00s [136/155] Installing qt5-srpm-macros-0: 100% | 0.0 B/s | 768.0 B | 00m00s [137/155] Installing perl-srpm-macros-0 100% | 0.0 B/s | 1.1 KiB | 00m00s [138/155] Installing package-notes-srpm 100% | 2.0 MiB/s | 2.0 KiB | 00m00s [139/155] Installing openblas-srpm-macr 100% | 0.0 B/s | 384.0 B | 00m00s [140/155] Installing ocaml-srpm-macros- 100% | 0.0 B/s | 2.2 KiB | 00m00s [141/155] Installing kernel-srpm-macros 100% | 0.0 B/s | 2.3 KiB | 00m00s [142/155] Installing gnat-srpm-macros-0 100% | 0.0 B/s | 1.3 KiB | 00m00s [143/155] Installing ghc-srpm-macros-0: 100% | 0.0 B/s | 648.0 B | 00m00s [144/155] Installing fpc-srpm-macros-0: 100% | 0.0 B/s | 420.0 B | 00m00s [145/155] Installing ansible-srpm-macro 100% | 35.4 MiB/s | 36.2 KiB | 00m00s [146/155] Installing fonts-srpm-macros- 100% | 55.1 MiB/s | 56.5 KiB | 00m00s [147/155] Installing forge-srpm-macros- 100% | 37.7 MiB/s | 38.6 KiB | 00m00s [148/155] Installing go-srpm-macros-0:3 100% | 60.2 MiB/s | 61.6 KiB | 00m00s [149/155] Installing python-srpm-macros 100% | 50.1 MiB/s | 51.3 KiB | 00m00s [150/155] Installing redhat-rpm-config- 100% | 46.7 MiB/s | 191.4 KiB | 00m00s [151/155] Installing rpm-build-0:4.19.1 100% | 44.4 MiB/s | 182.0 KiB | 00m00s [152/155] Installing pyproject-srpm-mac 100% | 1.0 MiB/s | 2.1 KiB | 00m00s [153/155] Installing util-linux-0:2.40- 100% | 88.6 MiB/s | 3.7 MiB | 00m00s >>> Running post-install scriptlet: util-linux-0:2.40-0.9.rc1.fc41.x86_64 >>> Stop post-install scriptlet: util-linux-0:2.40-0.9.rc1.fc41.x86_64 [154/155] Installing which-0:2.21-41.fc 100% | 40.3 MiB/s | 82.4 KiB | 00m00s [155/155] Installing info-0:7.1-2.fc40. 100% | 266.5 KiB/s | 358.2 KiB | 00m01s >>> Running post-transaction scriptlet: filesystem-0:3.18-8.fc40.x86_64 >>> Stop post-transaction scriptlet: filesystem-0:3.18-8.fc40.x86_64 >>> Running post-transaction scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.f >>> Stop post-transaction scriptlet: ca-certificates-0:2023.2.62_v7.0.401-6.fc40 >>> Running post-transaction scriptlet: authselect-libs-0:1.5.0-5.fc41.x86_64 >>> Stop post-transaction scriptlet: authselect-libs-0:1.5.0-5.fc41.x86_64 >>> Running post-transaction scriptlet: rpm-0:4.19.1.1-1.fc40.x86_64 >>> Stop post-transaction scriptlet: rpm-0:4.19.1.1-1.fc40.x86_64 >>> Running trigger-install scriptlet: glibc-common-0:2.39.9000-3.fc41.x86_64 >>> Stop trigger-install scriptlet: glibc-common-0:2.39.9000-3.fc41.x86_64 >>> Running trigger-install scriptlet: info-0:7.1-2.fc40.x86_64 >>> Stop trigger-install scriptlet: info-0:7.1-2.fc40.x86_64 Warning: skipped PGP checks for 3 package(s). Finish: installing minimal buildroot with dnf5 Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: alternatives-1.26-3.fc40.x86_64 ansible-srpm-macros-1-14.fc40.noarch audit-libs-4.0-8.fc41.x86_64 authselect-1.5.0-5.fc41.x86_64 authselect-libs-1.5.0-5.fc41.x86_64 basesystem-11-20.fc40.noarch bash-5.2.26-3.fc40.x86_64 binutils-2.42.50-4.fc41.x86_64 binutils-gold-2.42.50-4.fc41.x86_64 bzip2-1.0.8-18.fc40.x86_64 bzip2-libs-1.0.8-18.fc40.x86_64 ca-certificates-2023.2.62_v7.0.401-6.fc40.noarch coreutils-9.4-6.fc40.x86_64 coreutils-common-9.4-6.fc40.x86_64 cpio-2.15-1.fc40.x86_64 cracklib-2.9.11-5.fc40.x86_64 crypto-policies-20240201-1.git9f501f3.fc40.noarch curl-8.6.0-7.fc41.x86_64 cyrus-sasl-lib-2.1.28-19.fc40.x86_64 debugedit-5.0-14.fc40.x86_64 diffutils-3.10-5.fc40.x86_64 dwz-0.15-6.fc40.x86_64 ed-1.20.1-1.fc41.x86_64 efi-srpm-macros-5-11.fc40.noarch elfutils-0.190-6.fc40.x86_64 elfutils-debuginfod-client-0.190-6.fc40.x86_64 elfutils-default-yama-scope-0.190-6.fc40.noarch elfutils-libelf-0.190-6.fc40.x86_64 elfutils-libs-0.190-6.fc40.x86_64 fedora-gpg-keys-41-0.1.noarch fedora-release-41-0.5.noarch fedora-release-common-41-0.5.noarch fedora-release-identity-basic-41-0.5.noarch fedora-repos-41-0.1.noarch fedora-repos-rawhide-41-0.1.noarch file-5.45-5.fc41.x86_64 file-libs-5.45-5.fc41.x86_64 filesystem-3.18-8.fc40.x86_64 findutils-4.9.0-8.fc40.x86_64 fonts-srpm-macros-2.0.5-14.fc40.noarch forge-srpm-macros-0.2.0-3.fc40.noarch fpc-srpm-macros-1.3-12.fc40.noarch gawk-5.3.0-3.fc40.x86_64 gdb-minimal-14.1-8.fc40.x86_64 gdbm-1.23-6.fc40.x86_64 gdbm-libs-1.23-6.fc40.x86_64 ghc-srpm-macros-1.6.1-5.fc40.noarch glibc-2.39.9000-3.fc41.x86_64 glibc-common-2.39.9000-3.fc41.x86_64 glibc-gconv-extra-2.39.9000-3.fc41.x86_64 glibc-minimal-langpack-2.39.9000-3.fc41.x86_64 gmp-6.3.0-1.fc41.x86_64 gnat-srpm-macros-6-5.fc40.noarch go-srpm-macros-3.4.0-2.fc40.noarch gpg-pubkey-a15b79cc-63d04c2c gpg-pubkey-e99d6ad1-64d2612c grep-3.11-7.fc40.x86_64 gzip-1.13-1.fc40.x86_64 info-7.1-2.fc40.x86_64 jansson-2.13.1-9.fc40.x86_64 kernel-srpm-macros-1.0-22.fc40.noarch keyutils-libs-1.6.3-3.fc40.x86_64 krb5-libs-1.21.2-5.fc40.x86_64 libacl-2.3.2-1.fc40.x86_64 libarchive-3.7.2-3.fc40.x86_64 libattr-2.5.2-3.fc40.x86_64 libblkid-2.40-0.9.rc1.fc41.x86_64 libbrotli-1.1.0-3.fc40.x86_64 libcap-2.69-3.fc40.x86_64 libcap-ng-0.8.4-4.fc40.x86_64 libcom_err-1.47.0-5.fc40.x86_64 libcurl-8.6.0-7.fc41.x86_64 libeconf-0.5.2-3.fc40.x86_64 libevent-2.1.12-12.fc40.x86_64 libfdisk-2.40-0.9.rc1.fc41.x86_64 libffi-3.4.4-7.fc40.x86_64 libgcc-14.0.1-0.7.fc41.x86_64 libgomp-14.0.1-0.7.fc41.x86_64 libidn2-2.3.7-1.fc40.x86_64 libmount-2.40-0.9.rc1.fc41.x86_64 libnghttp2-1.59.0-2.fc40.x86_64 libnsl2-2.0.1-1.fc40.x86_64 libpkgconf-2.1.0-1.fc40.x86_64 libpsl-0.21.5-3.fc40.x86_64 libpwquality-1.4.5-9.fc40.x86_64 libselinux-3.6-4.fc40.x86_64 libsemanage-3.6-3.fc40.x86_64 libsepol-3.6-3.fc40.x86_64 libsmartcols-2.40-0.9.rc1.fc41.x86_64 libssh-0.10.6-4.fc40.x86_64 libssh-config-0.10.6-4.fc40.noarch libstdc++-14.0.1-0.7.fc41.x86_64 libtasn1-4.19.0-6.fc40.x86_64 libtirpc-1.3.4-1.rc2.fc40.2.x86_64 libtool-ltdl-2.4.7-10.fc40.x86_64 libunistring-1.1-7.fc41.x86_64 libutempter-1.2.1-13.fc40.x86_64 libuuid-2.40-0.9.rc1.fc41.x86_64 libverto-0.3.2-8.fc40.x86_64 libxcrypt-4.4.36-5.fc40.x86_64 libxml2-2.12.5-1.fc40.x86_64 libzstd-1.5.5-5.fc40.x86_64 lua-libs-5.4.6-5.fc40.x86_64 lua-srpm-macros-1-13.fc40.noarch lz4-libs-1.9.4-6.fc40.x86_64 mpfr-4.2.1-3.fc40.x86_64 ncurses-base-6.4-12.20240127.fc40.noarch ncurses-libs-6.4-12.20240127.fc40.x86_64 ocaml-srpm-macros-9-3.fc40.noarch openblas-srpm-macros-2-16.fc40.noarch openldap-2.6.7-1.fc40.x86_64 openssl-libs-3.2.1-2.fc40.x86_64 p11-kit-0.25.3-4.fc40.x86_64 p11-kit-trust-0.25.3-4.fc40.x86_64 package-notes-srpm-macros-0.5-11.fc40.noarch pam-1.6.0-2.fc41.x86_64 pam-libs-1.6.0-2.fc41.x86_64 patch-2.7.6-24.fc40.x86_64 pcre2-10.42-2.fc40.2.x86_64 pcre2-syntax-10.42-2.fc40.2.noarch perl-srpm-macros-1-53.fc40.noarch pkgconf-2.1.0-1.fc40.x86_64 pkgconf-m4-2.1.0-1.fc40.noarch pkgconf-pkg-config-2.1.0-1.fc40.x86_64 popt-1.19-6.fc40.x86_64 publicsuffix-list-dafsa-20240107-3.fc40.noarch pyproject-srpm-macros-1.12.0-1.fc40.noarch python-srpm-macros-3.12-7.fc40.noarch qt5-srpm-macros-5.15.12-3.fc40.noarch qt6-srpm-macros-6.6.2-1.fc41.noarch readline-8.2-8.fc40.x86_64 redhat-rpm-config-285-1.fc41.noarch rpm-4.19.1.1-1.fc40.x86_64 rpm-build-4.19.1.1-1.fc40.x86_64 rpm-build-libs-4.19.1.1-1.fc40.x86_64 rpm-libs-4.19.1.1-1.fc40.x86_64 rpm-sequoia-1.6.0-2.fc40.x86_64 rust-srpm-macros-26.1-1.fc41.noarch sed-4.9-1.fc40.x86_64 setup-2.14.5-2.fc40.noarch shadow-utils-4.15.0rc2-1.fc41.x86_64 sqlite-libs-3.45.1-2.fc40.x86_64 systemd-libs-255.3-1.fc40.x86_64 tar-1.35-3.fc40.x86_64 unzip-6.0-63.fc40.x86_64 util-linux-2.40-0.9.rc1.fc41.x86_64 util-linux-core-2.40-0.9.rc1.fc41.x86_64 which-2.21-41.fc40.x86_64 xxhash-libs-0.8.2-2.fc40.x86_64 xz-5.4.6-1.fc40.x86_64 xz-libs-5.4.6-1.fc40.x86_64 zig-srpm-macros-1-2.fc40.noarch zip-3.0-40.fc40.x86_64 zlib-ng-compat-2.1.6-2.fc40.x86_64 zstd-1.5.5-5.fc40.x86_64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1705968000 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-4.fc41.src.rpm Finish: rpmbuild -bs cp: preserving permissions for ‘/var/lib/copr-rpmbuild/results/chroot_scan/var/lib/mock/fedora-rawhide-x86_64-1709165765.183624/root/var/log’: No such file or directory INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1709165765.183624/root/var/log/dnf5.log Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-zdlxzvtw/bowtie/bowtie.spec) Config(child) 0 minutes 27 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-4.fc41.src.rpm) Config(fedora-rawhide-x86_64) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1709165765.183624/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1709165765.183624/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1709165765.183624/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.19.1.1-1.fc40.x86_64 rpm-sequoia-1.6.0-2.fc40.x86_64 python3-dnf-4.19.0-1.fc40.noarch yum-4.19.0-1.fc40.noarch dnf5-5.1.13-1.fc41.x86_64 dnf5-plugins-5.1.13-1.fc41.x86_64 Finish: chroot init Start: build phase for bowtie-1.3.1-4.fc41.src.rpm Start: build setup for bowtie-1.3.1-4.fc41.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1705968000 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-4.fc41.src.rpm Updating and loading repositories: fedora 100% | 640.7 KiB/s | 17.3 KiB | 00m00s Copr repository 100% | 49.4 KiB/s | 1.5 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing: gcc-c++ x86_64 14.0.1-0.7.fc41 fedora 37.9 MiB hostname x86_64 3.23-12.fc40 fedora 45.6 KiB make x86_64 1:4.4.1-6.fc40 fedora 1.8 MiB perl-Clone x86_64 0.46-6.fc40 fedora 32.4 KiB perl-Data-Dumper x86_64 2.188-503.fc40 fedora 111.7 KiB perl-FindBin noarch 1.53-506.fc40 fedora 6.4 KiB perl-Getopt-Long noarch 1:2.57-3.fc40 fedora 144.1 KiB perl-Test-Deep noarch 1.204-5.fc40 fedora 262.6 KiB perl-interpreter x86_64 4:5.38.2-506.fc40 fedora 119.8 KiB perl-lib x86_64 0.65-506.fc40 fedora 8.5 KiB python3 x86_64 3.12.2-2.fc41 fedora 31.9 KiB tbb-devel x86_64 2021.11.0-5.fc40 fedora 1.3 MiB zlib-ng-compat-devel x86_64 2.1.6-2.fc40 fedora 103.4 KiB Installing dependencies: annobin-docs noarch 12.41-1.fc41 copr_base 95.6 KiB annobin-plugin-gcc x86_64 12.41-1.fc41 copr_base 967.3 KiB cmake-filesystem x86_64 3.28.2-1.fc40 fedora 0.0 B cpp x86_64 14.0.1-0.7.fc41 fedora 34.8 MiB expat x86_64 2.6.0-1.fc41 fedora 276.9 KiB gc x86_64 8.2.2-6.fc40 fedora 258.7 KiB gcc x86_64 14.0.1-0.7.fc41 fedora 103.2 MiB gcc-plugin-annobin x86_64 14.0.1-0.7.fc41 fedora 57.1 KiB glibc-devel x86_64 2.39.9000-3.fc41 fedora 37.1 KiB glibc-headers-x86 noarch 2.39.9000-3.fc41 fedora 2.2 MiB groff-base x86_64 1.23.0-6.fc40 fedora 3.8 MiB guile30 x86_64 3.0.7-12.fc40 fedora 51.5 MiB hwloc-libs x86_64 2.10.0-3.fc40 fedora 2.8 MiB kernel-headers x86_64 6.8.0-0.rc6.49.fc41 fedora 6.2 MiB libb2 x86_64 0.98.1-11.fc40 fedora 42.2 KiB libmpc x86_64 1.3.1-5.fc40 fedora 164.7 KiB libstdc++-devel x86_64 14.0.1-0.7.fc41 fedora 15.3 MiB libxcrypt-devel x86_64 4.4.36-5.fc40 fedora 30.3 KiB mpdecimal x86_64 2.5.1-9.fc40 fedora 200.9 KiB ncurses x86_64 6.4-12.20240127.fc40 fedora 621.0 KiB perl-AutoLoader noarch 5.74-506.fc40 fedora 20.5 KiB perl-B x86_64 1.88-506.fc40 fedora 492.4 KiB perl-Carp noarch 1.54-502.fc40 fedora 46.5 KiB perl-Class-Struct noarch 0.68-506.fc40 fedora 25.4 KiB perl-Digest noarch 1.20-502.fc40 fedora 35.2 KiB perl-Digest-MD5 x86_64 2.59-3.fc40 fedora 59.7 KiB perl-DynaLoader x86_64 1.54-506.fc40 fedora 32.1 KiB perl-Encode x86_64 4:3.20-504.fc41 fedora 4.7 MiB perl-Errno x86_64 1.37-506.fc40 fedora 8.3 KiB perl-Exporter noarch 5.78-3.fc40 fedora 54.2 KiB perl-Fcntl x86_64 1.15-506.fc40 fedora 24.6 KiB perl-File-Basename noarch 2.86-506.fc40 fedora 14.0 KiB perl-File-Path noarch 2.18-503.fc40 fedora 63.5 KiB perl-File-Temp noarch 1:0.231.100-503.fc40 fedora 162.3 KiB perl-File-stat noarch 1.13-506.fc40 fedora 12.7 KiB perl-FileHandle noarch 2.05-506.fc40 fedora 9.3 KiB perl-Getopt-Std noarch 1.13-506.fc40 fedora 11.1 KiB perl-HTTP-Tiny noarch 0.088-5.fc40 fedora 152.1 KiB perl-IO x86_64 1.52-506.fc40 fedora 151.0 KiB perl-IO-Socket-IP noarch 0.42-2.fc40 fedora 98.6 KiB perl-IO-Socket-SSL noarch 2.085-1.fc40 fedora 685.0 KiB perl-IPC-Open3 noarch 1.22-506.fc40 fedora 22.4 KiB perl-JSON-PP noarch 1:4.16-503.fc40 fedora 141.7 KiB perl-MIME-Base64 x86_64 3.16-503.fc40 fedora 46.1 KiB perl-Math-BigInt noarch 1:2.0030.02-3.fc40 fedora 957.5 KiB perl-Math-Complex noarch 1.62-506.fc40 fedora 85.0 KiB perl-Mozilla-CA noarch 20231213-3.fc40 fedora 9.1 KiB perl-Net-SSLeay x86_64 1.94-3.fc40 fedora 1.3 MiB perl-Object-HashBase noarch 0.010-3.fc40 fedora 45.3 KiB perl-POSIX x86_64 2.13-506.fc40 fedora 229.0 KiB perl-PathTools x86_64 3.89-502.fc40 fedora 179.6 KiB perl-Pod-Escapes noarch 1:1.07-503.fc40 fedora 24.9 KiB perl-Pod-Perldoc noarch 3.28.01-503.fc40 fedora 163.1 KiB perl-Pod-Simple noarch 1:3.45-6.fc40 fedora 559.8 KiB perl-Pod-Usage noarch 4:2.03-503.fc40 fedora 84.7 KiB perl-Scalar-List-Utils x86_64 5:1.63-503.fc40 fedora 145.5 KiB perl-SelectSaver noarch 1.02-506.fc40 fedora 2.2 KiB perl-Socket x86_64 4:2.037-5.fc40 fedora 123.6 KiB perl-Storable x86_64 1:3.32-502.fc40 fedora 232.3 KiB perl-Symbol noarch 1.09-506.fc40 fedora 6.8 KiB perl-Term-ANSIColor noarch 5.01-504.fc40 fedora 97.5 KiB perl-Term-Cap noarch 1.18-503.fc40 fedora 29.3 KiB perl-Term-Table noarch 0.018-3.fc40 fedora 59.9 KiB perl-Test-Simple noarch 3:1.302198-3.fc40 fedora 1.3 MiB perl-Text-ParseWords noarch 3.31-502.fc40 fedora 13.5 KiB perl-Text-Tabs+Wrap noarch 2023.0511-5.fc40 fedora 23.4 KiB perl-Time-HiRes x86_64 4:1.9775-502.fc40 fedora 119.7 KiB perl-Time-Local noarch 2:1.350-5.fc40 fedora 68.9 KiB perl-URI noarch 5.27-1.fc40 fedora 239.8 KiB perl-base noarch 2.27-506.fc40 fedora 12.5 KiB perl-constant noarch 1.33-503.fc40 fedora 26.2 KiB perl-if noarch 0.61.000-506.fc40 fedora 5.8 KiB perl-libnet noarch 3.15-503.fc40 fedora 289.0 KiB perl-libs x86_64 4:5.38.2-506.fc40 fedora 9.8 MiB perl-locale noarch 1.10-506.fc40 fedora 6.2 KiB perl-mro x86_64 1.28-506.fc40 fedora 41.6 KiB perl-overload noarch 1.37-506.fc40 fedora 71.5 KiB perl-overloading noarch 0.02-506.fc40 fedora 4.8 KiB perl-parent noarch 1:0.241-502.fc40 fedora 9.7 KiB perl-podlators noarch 1:5.01-502.fc40 fedora 308.1 KiB perl-vars noarch 1.05-506.fc40 fedora 3.9 KiB python-pip-wheel noarch 24.0-1.fc41 copr_base 1.5 MiB python3-libs x86_64 3.12.2-2.fc41 fedora 41.0 MiB tbb x86_64 2021.11.0-5.fc40 fedora 440.9 KiB tbb-bind x86_64 2021.11.0-5.fc40 fedora 23.7 KiB tzdata noarch 2024a-2.fc40 fedora 1.6 MiB Transaction Summary: Installing: 99 packages Total size of inbound packages is 101 MiB. Need to download 20 MiB. After this operation 333 MiB will be used (install 333 MiB, remove 0 B). [ 1/99] hostname-0:3.23-12.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 2/99] make-1:4.4.1-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 3/99] perl-Data-Dumper-0:2.188-503.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 4/99] perl-Getopt-Long-1:2.57-3.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/99] perl-lib-0:0.65-506.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/99] perl-interpreter-4:5.38.2-506.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/99] python3-0:3.12.2-2.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/99] zlib-ng-compat-devel-0:2.1.6-2. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/99] guile30-0:3.0.7-12.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [10/99] perl-AutoLoader-0:5.74-506.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [11/99] perl-Exporter-0:5.78-3.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [12/99] perl-libs-4:5.38.2-506.fc40.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [13/99] perl-B-0:1.88-506.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [14/99] perl-Carp-0:1.54-502.fc40.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [15/99] perl-Scalar-List-Utils-5:1.63-5 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [16/99] perl-constant-0:1.33-503.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [17/99] perl-File-Basename-0:2.86-506.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [18/99] perl-PathTools-0:3.89-502.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [19/99] perl-Text-ParseWords-0:3.31-502 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [20/99] perl-base-0:2.27-506.fc40.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [21/99] perl-overload-0:1.37-506.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [22/99] gcc-0:14.0.1-0.7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [23/99] libmpc-0:1.3.1-5.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [24/99] python3-libs-0:3.12.2-2.fc41.x8 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [25/99] cmake-filesystem-0:3.28.2-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [26/99] gc-0:8.2.2-6.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [27/99] perl-DynaLoader-0:1.54-506.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [28/99] perl-if-0:0.61.000-506.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [29/99] perl-overloading-0:0.02-506.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [30/99] perl-Errno-0:1.37-506.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [31/99] perl-mro-0:1.28-506.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [32/99] perl-File-Temp-1:0.231.100-503. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [33/99] perl-IO-0:1.52-506.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [34/99] perl-POSIX-0:2.13-506.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [35/99] perl-Storable-1:3.32-502.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [36/99] perl-Symbol-0:1.09-506.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [37/99] perl-Term-ANSIColor-0:5.01-504. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [38/99] perl-vars-0:1.05-506.fc40.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [39/99] cpp-0:14.0.1-0.7.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [40/99] expat-0:2.6.0-1.fc41.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [41/99] libb2-0:0.98.1-11.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [42/99] mpdecimal-0:2.5.1-9.fc40.x86_64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [43/99] tzdata-0:2024a-2.fc40.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [44/99] perl-Fcntl-0:1.15-506.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [45/99] perl-File-Path-0:2.18-503.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [46/99] perl-parent-1:0.241-502.fc40.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [47/99] perl-File-stat-0:1.13-506.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [48/99] perl-SelectSaver-0:1.02-506.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [49/99] perl-Socket-4:2.037-5.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [50/99] perl-locale-0:1.10-506.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [51/99] perl-Class-Struct-0:0.68-506.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [52/99] gcc-plugin-annobin-0:14.0.1-0.7 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [53/99] python-pip-wheel-0:24.0-1.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [54/99] perl-Encode-4:3.20-504.fc41.x86 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [55/99] perl-Getopt-Std-0:1.13-506.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [56/99] perl-MIME-Base64-0:3.16-503.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [57/99] annobin-plugin-gcc-0:12.41-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [58/99] annobin-docs-0:12.41-1.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [59/99] glibc-devel-0:2.39.9000-3.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [60/99] glibc-headers-x86-0:2.39.9000-3 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [61/99] libxcrypt-devel-0:4.4.36-5.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [62/99] kernel-headers-0:6.8.0-0.rc6.49 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [63/99] perl-Pod-Usage-4:2.03-503.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [64/99] perl-Pod-Perldoc-0:3.28.01-503. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [65/99] perl-podlators-1:5.01-502.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [66/99] groff-base-0:1.23.0-6.fc40.x86_ 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [67/99] perl-HTTP-Tiny-0:0.088-5.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [68/99] perl-IPC-Open3-0:1.22-506.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [69/99] perl-Pod-Simple-1:3.45-6.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [70/99] perl-Term-Cap-0:1.18-503.fc40.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [71/99] perl-IO-Socket-SSL-0:2.085-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [72/99] perl-Mozilla-CA-0:20231213-3.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [73/99] perl-Net-SSLeay-0:1.94-3.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [74/99] perl-Time-Local-2:1.350-5.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [75/99] perl-Pod-Escapes-1:1.07-503.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [76/99] perl-Text-Tabs+Wrap-0:2023.0511 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [77/99] ncurses-0:6.4-12.20240127.fc40. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [78/99] perl-IO-Socket-IP-0:0.42-2.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [79/99] perl-URI-0:5.27-1.fc40.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [80/99] perl-libnet-0:3.15-503.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [81/99] perl-Digest-MD5-0:2.59-3.fc40.x 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [82/99] perl-FileHandle-0:2.05-506.fc40 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [83/99] perl-Digest-0:1.20-502.fc40.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [84/99] perl-FindBin-0:1.53-506.fc40.no 100% | 79.8 KiB/s | 14.4 KiB | 00m00s [85/99] perl-Clone-0:0.46-6.fc40.x86_64 100% | 104.7 KiB/s | 22.1 KiB | 00m00s [86/99] perl-Test-Deep-0:1.204-5.fc40.n 100% | 379.0 KiB/s | 121.3 KiB | 00m00s [87/99] tbb-devel-0:2021.11.0-5.fc40.x8 100% | 1.2 MiB/s | 240.0 KiB | 00m00s [88/99] tbb-0:2021.11.0-5.fc40.x86_64 100% | 2.3 MiB/s | 163.3 KiB | 00m00s [89/99] perl-Test-Simple-3:1.302198-3.f 100% | 3.3 MiB/s | 576.9 KiB | 00m00s [90/99] tbb-bind-0:2021.11.0-5.fc40.x86 100% | 384.9 KiB/s | 18.9 KiB | 00m00s [91/99] perl-JSON-PP-1:4.16-503.fc40.no 100% | 1.3 MiB/s | 66.5 KiB | 00m00s [92/99] perl-Term-Table-0:0.018-3.fc40. 100% | 671.5 KiB/s | 34.2 KiB | 00m00s [93/99] perl-Time-HiRes-4:1.9775-502.fc 100% | 1.1 MiB/s | 57.2 KiB | 00m00s [94/99] perl-Math-BigInt-1:2.0030.02-3. 100% | 3.6 MiB/s | 230.5 KiB | 00m00s [95/99] perl-Object-HashBase-0:0.010-3. 100% | 526.1 KiB/s | 25.8 KiB | 00m00s [96/99] gcc-c++-0:14.0.1-0.7.fc41.x86_6 100% | 25.8 MiB/s | 14.1 MiB | 00m01s [97/99] perl-Math-Complex-0:1.62-506.fc 100% | 930.1 KiB/s | 46.5 KiB | 00m00s [98/99] libstdc++-devel-0:14.0.1-0.7.fc 100% | 21.8 MiB/s | 2.7 MiB | 00m00s [99/99] hwloc-libs-0:2.10.0-3.fc40.x86_ 100% | 6.7 MiB/s | 2.1 MiB | 00m00s -------------------------------------------------------------------------------- [99/99] Total 100% | 21.9 MiB/s | 20.5 MiB | 00m01s Running transaction [ 1/101] Verify package files 100% | 234.0 B/s | 99.0 B | 00m00s [ 2/101] Prepare transaction 100% | 1.0 KiB/s | 99.0 B | 00m00s [ 3/101] Installing libmpc-0:1.3.1-5.f 100% | 81.2 MiB/s | 166.2 KiB | 00m00s [ 4/101] Installing tbb-0:2021.11.0-5. 100% | 144.4 MiB/s | 443.7 KiB | 00m00s [ 5/101] Installing cpp-0:14.0.1-0.7.f 100% | 273.7 MiB/s | 34.8 MiB | 00m00s [ 6/101] Installing ncurses-0:6.4-12.2 100% | 29.2 MiB/s | 627.6 KiB | 00m00s >>> Running pre-install scriptlet: groff-base-0:1.23.0-6.fc40.x86_64 >>> Stop pre-install scriptlet: groff-base-0:1.23.0-6.fc40.x86_64 [ 7/101] Installing groff-base-0:1.23. 100% | 104.3 MiB/s | 3.9 MiB | 00m00s >>> Running post-install scriptlet: groff-base-0:1.23.0-6.fc40.x86_64 >>> Stop post-install scriptlet: groff-base-0:1.23.0-6.fc40.x86_64 [ 8/101] Installing perl-Digest-0:1.20 100% | 36.1 MiB/s | 37.0 KiB | 00m00s [ 9/101] Installing perl-B-0:1.88-506. 100% | 121.0 MiB/s | 495.7 KiB | 00m00s [ 10/101] Installing perl-FileHandle-0: 100% | 9.5 MiB/s | 9.8 KiB | 00m00s [ 11/101] Installing perl-Digest-MD5-0: 100% | 30.1 MiB/s | 61.6 KiB | 00m00s [ 12/101] Installing perl-libnet-0:3.15 100% | 95.8 MiB/s | 294.3 KiB | 00m00s [ 13/101] Installing perl-Data-Dumper-0 100% | 55.4 MiB/s | 113.6 KiB | 00m00s [ 14/101] Installing perl-AutoLoader-0: 100% | 20.5 MiB/s | 20.9 KiB | 00m00s [ 15/101] Installing perl-URI-0:5.27-1. 100% | 49.1 MiB/s | 251.4 KiB | 00m00s [ 16/101] Installing perl-if-0:0.61.000 100% | 0.0 B/s | 6.2 KiB | 00m00s [ 17/101] Installing perl-File-Path-0:2 100% | 63.0 MiB/s | 64.5 KiB | 00m00s [ 18/101] Installing perl-locale-0:1.10 100% | 6.5 MiB/s | 6.6 KiB | 00m00s [ 19/101] Installing perl-Mozilla-CA-0: 100% | 9.9 MiB/s | 10.2 KiB | 00m00s [ 20/101] Installing perl-Net-SSLeay-0: 100% | 136.3 MiB/s | 1.4 MiB | 00m00s [ 21/101] Installing perl-Time-Local-2: 100% | 68.9 MiB/s | 70.5 KiB | 00m00s [ 22/101] Installing perl-Pod-Escapes-1 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [ 23/101] Installing perl-Text-Tabs+Wra 100% | 24.1 MiB/s | 24.7 KiB | 00m00s [ 24/101] Installing perl-IO-Socket-IP- 100% | 49.0 MiB/s | 100.4 KiB | 00m00s [ 25/101] Installing perl-IO-Socket-SSL 100% | 168.2 MiB/s | 689.0 KiB | 00m00s [ 26/101] Installing perl-Term-ANSIColo 100% | 96.8 MiB/s | 99.1 KiB | 00m00s [ 27/101] Installing perl-POSIX-0:2.13- 100% | 112.4 MiB/s | 230.3 KiB | 00m00s [ 28/101] Installing perl-File-Temp-1:0 100% | 160.2 MiB/s | 164.0 KiB | 00m00s [ 29/101] Installing perl-Class-Struct- 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [ 30/101] Installing perl-IPC-Open3-0:1 100% | 22.7 MiB/s | 23.3 KiB | 00m00s [ 31/101] Installing perl-Term-Cap-0:1. 100% | 29.8 MiB/s | 30.5 KiB | 00m00s [ 32/101] Installing perl-Pod-Simple-1: 100% | 139.0 MiB/s | 569.4 KiB | 00m00s [ 33/101] Installing perl-HTTP-Tiny-0:0 100% | 75.3 MiB/s | 154.2 KiB | 00m00s [ 34/101] Installing perl-Symbol-0:1.09 100% | 7.0 MiB/s | 7.2 KiB | 00m00s [ 35/101] Installing perl-SelectSaver-0 100% | 2.5 MiB/s | 2.6 KiB | 00m00s [ 36/101] Installing perl-Socket-4:2.03 100% | 61.3 MiB/s | 125.6 KiB | 00m00s [ 37/101] Installing perl-File-stat-0:1 100% | 12.9 MiB/s | 13.2 KiB | 00m00s [ 38/101] Installing perl-podlators-1:5 100% | 101.6 MiB/s | 312.1 KiB | 00m00s [ 39/101] Installing perl-Pod-Perldoc-0 100% | 54.9 MiB/s | 168.6 KiB | 00m00s [ 40/101] Installing perl-Text-ParseWor 100% | 14.2 MiB/s | 14.5 KiB | 00m00s [ 41/101] Installing perl-base-0:2.27-5 100% | 0.0 B/s | 12.9 KiB | 00m00s [ 42/101] Installing perl-overloading-0 100% | 5.4 MiB/s | 5.5 KiB | 00m00s [ 43/101] Installing perl-mro-0:1.28-50 100% | 41.7 MiB/s | 42.7 KiB | 00m00s [ 44/101] Installing perl-Fcntl-0:1.15- 100% | 25.1 MiB/s | 25.8 KiB | 00m00s [ 45/101] Installing perl-IO-0:1.52-506 100% | 50.6 MiB/s | 155.3 KiB | 00m00s [ 46/101] Installing perl-Pod-Usage-4:2 100% | 84.2 MiB/s | 86.3 KiB | 00m00s [ 47/101] Installing perl-Scalar-List-U 100% | 48.4 MiB/s | 148.7 KiB | 00m00s [ 48/101] Installing perl-constant-0:1. 100% | 26.7 MiB/s | 27.4 KiB | 00m00s [ 49/101] Installing perl-File-Basename 100% | 14.2 MiB/s | 14.6 KiB | 00m00s [ 50/101] Installing perl-Errno-0:1.37- 100% | 0.0 B/s | 8.8 KiB | 00m00s [ 51/101] Installing perl-overload-0:1. 100% | 70.3 MiB/s | 71.9 KiB | 00m00s [ 52/101] Installing perl-vars-0:1.05-5 100% | 0.0 B/s | 4.3 KiB | 00m00s [ 53/101] Installing perl-parent-1:0.24 100% | 10.2 MiB/s | 10.4 KiB | 00m00s [ 54/101] Installing perl-Storable-1:3. 100% | 114.2 MiB/s | 233.9 KiB | 00m00s [ 55/101] Installing perl-Getopt-Std-0: 100% | 11.4 MiB/s | 11.6 KiB | 00m00s [ 56/101] Installing perl-MIME-Base64-0 100% | 23.6 MiB/s | 48.3 KiB | 00m00s [ 57/101] Installing perl-Getopt-Long-1 100% | 71.6 MiB/s | 146.7 KiB | 00m00s [ 58/101] Installing perl-Exporter-0:5. 100% | 54.2 MiB/s | 55.5 KiB | 00m00s [ 59/101] Installing perl-Carp-0:1.54-5 100% | 46.5 MiB/s | 47.7 KiB | 00m00s [ 60/101] Installing perl-PathTools-0:3 100% | 59.9 MiB/s | 184.2 KiB | 00m00s [ 61/101] Installing perl-DynaLoader-0: 100% | 31.7 MiB/s | 32.5 KiB | 00m00s [ 62/101] Installing perl-Encode-4:3.20 100% | 214.4 MiB/s | 4.7 MiB | 00m00s [ 63/101] Installing perl-libs-4:5.38.2 100% | 148.4 MiB/s | 9.9 MiB | 00m00s [ 64/101] Installing perl-interpreter-4 100% | 59.3 MiB/s | 121.4 KiB | 00m00s [ 65/101] Installing perl-Time-HiRes-4: 100% | 59.5 MiB/s | 121.8 KiB | 00m00s [ 66/101] Installing perl-Object-HashBa 100% | 45.5 MiB/s | 46.6 KiB | 00m00s [ 67/101] Installing perl-Term-Table-0: 100% | 30.7 MiB/s | 62.8 KiB | 00m00s [ 68/101] Installing perl-Math-Complex- 100% | 83.8 MiB/s | 85.8 KiB | 00m00s [ 69/101] Installing perl-Math-BigInt-1 100% | 187.8 MiB/s | 961.6 KiB | 00m00s [ 70/101] Installing perl-JSON-PP-1:4.1 100% | 46.7 MiB/s | 143.4 KiB | 00m00s [ 71/101] Installing perl-Test-Simple-3 100% | 44.9 MiB/s | 1.4 MiB | 00m00s [ 72/101] Installing kernel-headers-0:6 100% | 112.0 MiB/s | 6.4 MiB | 00m00s [ 73/101] Installing glibc-headers-x86- 100% | 90.2 MiB/s | 2.3 MiB | 00m00s [ 74/101] Installing libxcrypt-devel-0: 100% | 15.9 MiB/s | 32.6 KiB | 00m00s [ 75/101] Installing glibc-devel-0:2.39 100% | 19.9 MiB/s | 40.8 KiB | 00m00s [ 76/101] Installing annobin-docs-0:12. 100% | 31.4 MiB/s | 96.6 KiB | 00m00s [ 77/101] Installing libstdc++-devel-0: 100% | 208.9 MiB/s | 15.5 MiB | 00m00s [ 78/101] Installing python-pip-wheel-0 100% | 382.0 MiB/s | 1.5 MiB | 00m00s [ 79/101] Installing hwloc-libs-0:2.10. 100% | 316.7 MiB/s | 2.8 MiB | 00m00s [ 80/101] Installing tbb-bind-0:2021.11 100% | 6.0 MiB/s | 24.6 KiB | 00m00s [ 81/101] Installing tzdata-0:2024a-2.f 100% | 26.4 MiB/s | 1.9 MiB | 00m00s [ 82/101] Installing mpdecimal-0:2.5.1- 100% | 98.6 MiB/s | 202.0 KiB | 00m00s [ 83/101] Installing libb2-0:0.98.1-11. 100% | 42.3 MiB/s | 43.3 KiB | 00m00s [ 84/101] Installing expat-0:2.6.0-1.fc 100% | 34.1 MiB/s | 278.9 KiB | 00m00s [ 85/101] Installing python3-libs-0:3.1 100% | 165.6 MiB/s | 41.4 MiB | 00m00s [ 86/101] Installing python3-0:3.12.2-2 100% | 32.8 MiB/s | 33.6 KiB | 00m00s [ 87/101] Installing gc-0:8.2.2-6.fc40. 100% | 63.8 MiB/s | 261.2 KiB | 00m00s [ 88/101] Installing guile30-0:3.0.7-12 100% | 299.9 MiB/s | 51.6 MiB | 00m00s [ 89/101] Installing make-1:4.4.1-6.fc4 100% | 150.0 MiB/s | 1.8 MiB | 00m00s [ 90/101] Installing gcc-0:14.0.1-0.7.f 100% | 284.5 MiB/s | 103.3 MiB | 00m00s >>> Running trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch >>> Stop trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch [ 91/101] Installing cmake-filesystem-0 100% | 1.7 MiB/s | 7.1 KiB | 00m00s [ 92/101] Installing tbb-devel-0:2021.1 100% | 122.2 MiB/s | 1.3 MiB | 00m00s [ 93/101] Installing gcc-c++-0:14.0.1-0 100% | 268.9 MiB/s | 37.9 MiB | 00m00s [ 94/101] Installing gcc-plugin-annobin 100% | 2.0 MiB/s | 58.7 KiB | 00m00s >>> Running trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch >>> Stop trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch [ 95/101] Installing annobin-plugin-gcc 100% | 28.7 MiB/s | 968.8 KiB | 00m00s >>> Running trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch >>> Stop trigger-install scriptlet: redhat-rpm-config-0:285-1.fc41.noarch [ 96/101] Installing perl-Test-Deep-0:1 100% | 38.8 MiB/s | 277.8 KiB | 00m00s [ 97/101] Installing perl-Clone-0:0.46- 100% | 11.1 MiB/s | 34.1 KiB | 00m00s [ 98/101] Installing perl-FindBin-0:1.5 100% | 2.2 MiB/s | 6.8 KiB | 00m00s [ 99/101] Installing perl-lib-0:0.65-50 100% | 8.7 MiB/s | 8.9 KiB | 00m00s [100/101] Installing zlib-ng-compat-dev 100% | 51.0 MiB/s | 104.5 KiB | 00m00s [101/101] Installing hostname-0:3.23-12 100% | 189.6 KiB/s | 48.5 KiB | 00m00s >>> Running post-install scriptlet: hostname-0:3.23-12.fc40.x86_64 >>> Stop post-install scriptlet: hostname-0:3.23-12.fc40.x86_64 >>> Running trigger-install scriptlet: glibc-common-0:2.39.9000-3.fc41.x86_64 >>> Stop trigger-install scriptlet: glibc-common-0:2.39.9000-3.fc41.x86_64 >>> Running trigger-install scriptlet: info-0:7.1-2.fc40.x86_64 >>> Stop trigger-install scriptlet: info-0:7.1-2.fc40.x86_64 Warning: skipped PGP checks for 3 package(s). Finish: build setup for bowtie-1.3.1-4.fc41.src.rpm Start: rpmbuild bowtie-1.3.1-4.fc41.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1705968000 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.KRU2Rh + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + rm -rf /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.GqW90v + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j2 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘bowtie_build’ at ebwt_build.cpp:541:11: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie_build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_build_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘bowtie_build’ at ebwt_build.cpp:541:11: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie_build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_build_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base ’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base .constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘patsrcFromStrings’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:49:15, inlined from ‘parsePair’ at ebwt_search.cpp:604:10, inlined from ‘parseOptions’ at ebwt_search.cpp:631:47, inlined from ‘bowtie’ at ebwt_search.cpp:3326:15: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base ’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base .constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘patsrcFromStrings’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:49:15, inlined from ‘parsePair’ at ebwt_search.cpp:604:10, inlined from ‘parseOptions’ at ebwt_search.cpp:631:47, inlined from ‘bowtie’ at ebwt_search.cpp:3326:15: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘bowtie_build’ at ebwt_build.cpp:541:11: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie_build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_build_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from ebwt_build.cpp:10: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘bowtie_build’ at ebwt_build.cpp:541:11: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bowtie_build’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_build_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8.constprop’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘bucketSortSufDcU8.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘patsrcFromStrings’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3015:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3033:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3035:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3054:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3056:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3081:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3083:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base .constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:49:15, inlined from ‘parsePair’ at ebwt_search.cpp:604:10, inlined from ‘parseOptions’ at ebwt_search.cpp:631:47: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘parseOptions’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘parseOptions’ at ebwt_search.cpp:661:13: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘parseOptions’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:251:19, inlined from ‘anchor64Find’ at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘anchor64Find’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:587:20, inlined from ‘anchor64Find’ at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘anchor64Find’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from aligner.h:18, from ebwt_search.cpp:17: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘patsrcFromStrings’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:49:15, inlined from ‘parsePair’ at ebwt_search.cpp:604:10, inlined from ‘parseOptions’ at ebwt_search.cpp:631:47: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘parseOptions’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘__ct_base .constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15, inlined from ‘main’ at bowtie_main.cpp:41:12: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘main’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3015:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3033:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3035:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3054:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3056:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3081:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘driver.constprop’ at ebwt_search.cpp:3083:21: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In function ‘driver.constprop’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:251:19, inlined from ‘anchor64Find’ at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘anchor64Find’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:587:20, inlined from ‘anchor64Find’ at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/14/new: In member function ‘anchor64Find’: /usr/include/c++/14/new:133:26: note: in a call to allocation function ‘operator new []’ declared here 133 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-01-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt.h:42, from bowtie_inspect.cpp:9: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:13: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.Lt6pUp + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64//usr/bin/ + /usr/bin/find-debuginfo -j2 --strict-build-id -m -i --build-id-seed 1.3.1-4.fc41 --unique-debug-suffix -1.3.1-4.fc41.x86_64 --unique-debug-src-base bowtie-1.3.1-4.fc41.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-4.fc41.x86_64 2935 blocks find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j2 + /usr/lib/rpm/redhat/brp-python-hardlink Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.AvkTOo + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-4.fc41.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.C2e4DW + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + export LC_ALL= + LC_ALL= + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.qokFPY + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/licenses/bowtie + export LC_ALL= + LC_ALL= + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-4.fc41 bowtie(x86-64) = 1.3.1-4.fc41 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libc.so.6(GLIBC_2.3.4)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_2.4)(64bit) libc.so.6(GLIBC_2.7)(64bit) libc.so.6(GLIBC_ABI_DT_RELR)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.15)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-4.fc41.x86_64 Provides: bowtie-debugsource = 1.3.1-4.fc41 bowtie-debugsource(x86-64) = 1.3.1-4.fc41 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-4.fc41.x86_64 Provides: bowtie-debuginfo = 1.3.1-4.fc41 bowtie-debuginfo(x86-64) = 1.3.1-4.fc41 debuginfo(build-id) = 24097b37a88bd08ea9f96bb6f2e9e78748aeca52 debuginfo(build-id) = 322a667d35300c62b713d1810a9ca16e1b245795 debuginfo(build-id) = 348b14eb46b72afd3e5f63f05e12aafe3a431d98 debuginfo(build-id) = 40a6bc885ec786493d023f705ba7c146fa9c53e9 debuginfo(build-id) = 6822b0fa8939dc18a5f8627fd53a9e0c38666c4f debuginfo(build-id) = 7517bfd4e95dad7705621b82541f30ee2a466618 debuginfo(build-id) = 860794a0fcc87cd43c3903e923da75427af9ae3b debuginfo(build-id) = b84c6657054459c16aed6f863da8cc41cbbaff4f debuginfo(build-id) = be3f55b7c1a0300c310cd7cab5b260b3246a46ba debuginfo(build-id) = cc1a76741fef4aee326375558f0e1d7b08625198 debuginfo(build-id) = f21a1469247b382830a285461595511797abcf31 debuginfo(build-id) = fbbe00fd109fafff7c4b4a6de7d3a2855126f3ef Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-4.fc41 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 Wrote: /builddir/build/RPMS/bowtie-1.3.1-4.fc41.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-4.fc41.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-4.fc41.x86_64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.Y5uS4H + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-4.fc41.x86_64 + RPM_EC=0 ++ jobs -p + exit 0 Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.rHpPDJ + umask 022 + cd /builddir/build/BUILD + rm -rf /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + rm -rf bowtie-1.3.1-src bowtie-1.3.1-src.gemspec + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-4.fc41.src.rpm Finish: build phase for bowtie-1.3.1-4.fc41.src.rpm INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1709165765.183624/root/var/log/dnf5.log INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-4.fc41.src.rpm) Config(child) 4 minutes 58 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "4.fc41", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "4.fc41", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "4.fc41", "arch": "src" }, { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "4.fc41", "arch": "x86_64" } ] } RPMResults finished